primary antibodies for lin28b Search Results


97
Vazyme Biotech Co wild type lin28b
a IHC was performed on a PDAC patient TMA with <t>LIN28B</t> antibody. High expression of LIN28B (LIN28B high ) and low expression of LIN28B (LIN28B low ) in tissues was shown. Scale bar: 30 μm. b Survival curves for PDAC patients with high (red) or low (blue) levels of LIN28B. Statistical analysis was performed using two-sided Gehan-Breslow-Wilcoxon test; P = 0.0139; n = 80 patients. c Percentages of total population of patients ( n = 80) or of patients at each pathological stage (stage I; n = 35, stage II; n = 20, stage III; n = 12, stage IV; n = 13) and histological T status (T1; n = 13, T2; n = 42, T3-4; n = 25) expressing high (red) or low (blue) levels of LIN28B. d Correlation between LIN28B IHC scores in stroma and tumors (Pearson product-moment correlation test; r = 0.9962, p < 0.001). e Immunofluorescence was performed on the PDAC patient TMA using LIN28B, α-SMA, and CK19 antibodies. Representative images from LIN28B high hPDAC and LIN28B low hPDAC were shown. Scale bar: 30 μm. f , g The levels of Lin28b in 14837T, 14838T, and 15376T were measured by real-time qPCR ( f ) and western blotting ( g ). P -value by one-way ANOVA with Tukey’s multiple comparison test. Representative of n = 3 independent experiments ( g ). h Orthotopic PDAC tumors generated with 14837T, 14838T, or 15376T were analyzed by Lin28b, α-SMA, and CK19 immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. i Lin28b high PDAC tumors were stained for Lin28b, Fap ( i ), and α-SMA ( j ) ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( f ). Data are shown as mean ± s.d.
Wild Type Lin28b, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+antibodies+for+lin28b/pmc10613206-416-26-22?v=Vazyme+Biotech+Co
Average 97 stars, based on 1 article reviews
wild type lin28b - by Bioz Stars, 2026-07
97/100 stars
  Buy from Supplier

95
Genecopoeia lin28b rabbit mab
a IHC was performed on a PDAC patient TMA with <t>LIN28B</t> antibody. High expression of LIN28B (LIN28B high ) and low expression of LIN28B (LIN28B low ) in tissues was shown. Scale bar: 30 μm. b Survival curves for PDAC patients with high (red) or low (blue) levels of LIN28B. Statistical analysis was performed using two-sided Gehan-Breslow-Wilcoxon test; P = 0.0139; n = 80 patients. c Percentages of total population of patients ( n = 80) or of patients at each pathological stage (stage I; n = 35, stage II; n = 20, stage III; n = 12, stage IV; n = 13) and histological T status (T1; n = 13, T2; n = 42, T3-4; n = 25) expressing high (red) or low (blue) levels of LIN28B. d Correlation between LIN28B IHC scores in stroma and tumors (Pearson product-moment correlation test; r = 0.9962, p < 0.001). e Immunofluorescence was performed on the PDAC patient TMA using LIN28B, α-SMA, and CK19 antibodies. Representative images from LIN28B high hPDAC and LIN28B low hPDAC were shown. Scale bar: 30 μm. f , g The levels of Lin28b in 14837T, 14838T, and 15376T were measured by real-time qPCR ( f ) and western blotting ( g ). P -value by one-way ANOVA with Tukey’s multiple comparison test. Representative of n = 3 independent experiments ( g ). h Orthotopic PDAC tumors generated with 14837T, 14838T, or 15376T were analyzed by Lin28b, α-SMA, and CK19 immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. i Lin28b high PDAC tumors were stained for Lin28b, Fap ( i ), and α-SMA ( j ) ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( f ). Data are shown as mean ± s.d.
Lin28b Rabbit Mab, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+antibodies+for+lin28b/custom%40mab-02325%4028218277?v=Genecopoeia
Average 95 stars, based on 1 article reviews
lin28b rabbit mab - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

91
Bethyl lin28b
a IHC was performed on a PDAC patient TMA with <t>LIN28B</t> antibody. High expression of LIN28B (LIN28B high ) and low expression of LIN28B (LIN28B low ) in tissues was shown. Scale bar: 30 μm. b Survival curves for PDAC patients with high (red) or low (blue) levels of LIN28B. Statistical analysis was performed using two-sided Gehan-Breslow-Wilcoxon test; P = 0.0139; n = 80 patients. c Percentages of total population of patients ( n = 80) or of patients at each pathological stage (stage I; n = 35, stage II; n = 20, stage III; n = 12, stage IV; n = 13) and histological T status (T1; n = 13, T2; n = 42, T3-4; n = 25) expressing high (red) or low (blue) levels of LIN28B. d Correlation between LIN28B IHC scores in stroma and tumors (Pearson product-moment correlation test; r = 0.9962, p < 0.001). e Immunofluorescence was performed on the PDAC patient TMA using LIN28B, α-SMA, and CK19 antibodies. Representative images from LIN28B high hPDAC and LIN28B low hPDAC were shown. Scale bar: 30 μm. f , g The levels of Lin28b in 14837T, 14838T, and 15376T were measured by real-time qPCR ( f ) and western blotting ( g ). P -value by one-way ANOVA with Tukey’s multiple comparison test. Representative of n = 3 independent experiments ( g ). h Orthotopic PDAC tumors generated with 14837T, 14838T, or 15376T were analyzed by Lin28b, α-SMA, and CK19 immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. i Lin28b high PDAC tumors were stained for Lin28b, Fap ( i ), and α-SMA ( j ) ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( f ). Data are shown as mean ± s.d.
Lin28b, supplied by Bethyl, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+antibodies+for+lin28b/pmc06659731-734-16-17?v=Bethyl
Average 91 stars, based on 1 article reviews
lin28b - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

91
Addgene inc pcdna3 flag lin28b
a IHC was performed on a PDAC patient TMA with <t>LIN28B</t> antibody. High expression of LIN28B (LIN28B high ) and low expression of LIN28B (LIN28B low ) in tissues was shown. Scale bar: 30 μm. b Survival curves for PDAC patients with high (red) or low (blue) levels of LIN28B. Statistical analysis was performed using two-sided Gehan-Breslow-Wilcoxon test; P = 0.0139; n = 80 patients. c Percentages of total population of patients ( n = 80) or of patients at each pathological stage (stage I; n = 35, stage II; n = 20, stage III; n = 12, stage IV; n = 13) and histological T status (T1; n = 13, T2; n = 42, T3-4; n = 25) expressing high (red) or low (blue) levels of LIN28B. d Correlation between LIN28B IHC scores in stroma and tumors (Pearson product-moment correlation test; r = 0.9962, p < 0.001). e Immunofluorescence was performed on the PDAC patient TMA using LIN28B, α-SMA, and CK19 antibodies. Representative images from LIN28B high hPDAC and LIN28B low hPDAC were shown. Scale bar: 30 μm. f , g The levels of Lin28b in 14837T, 14838T, and 15376T were measured by real-time qPCR ( f ) and western blotting ( g ). P -value by one-way ANOVA with Tukey’s multiple comparison test. Representative of n = 3 independent experiments ( g ). h Orthotopic PDAC tumors generated with 14837T, 14838T, or 15376T were analyzed by Lin28b, α-SMA, and CK19 immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. i Lin28b high PDAC tumors were stained for Lin28b, Fap ( i ), and α-SMA ( j ) ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( f ). Data are shown as mean ± s.d.
Pcdna3 Flag Lin28b, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+antibodies+for+lin28b/pmc05970092-187-8-14?v=Addgene+inc
Average 91 stars, based on 1 article reviews
pcdna3 flag lin28b - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

90
WuXi AppTec lin28b
a IHC was performed on a PDAC patient TMA with <t>LIN28B</t> antibody. High expression of LIN28B (LIN28B high ) and low expression of LIN28B (LIN28B low ) in tissues was shown. Scale bar: 30 μm. b Survival curves for PDAC patients with high (red) or low (blue) levels of LIN28B. Statistical analysis was performed using two-sided Gehan-Breslow-Wilcoxon test; P = 0.0139; n = 80 patients. c Percentages of total population of patients ( n = 80) or of patients at each pathological stage (stage I; n = 35, stage II; n = 20, stage III; n = 12, stage IV; n = 13) and histological T status (T1; n = 13, T2; n = 42, T3-4; n = 25) expressing high (red) or low (blue) levels of LIN28B. d Correlation between LIN28B IHC scores in stroma and tumors (Pearson product-moment correlation test; r = 0.9962, p < 0.001). e Immunofluorescence was performed on the PDAC patient TMA using LIN28B, α-SMA, and CK19 antibodies. Representative images from LIN28B high hPDAC and LIN28B low hPDAC were shown. Scale bar: 30 μm. f , g The levels of Lin28b in 14837T, 14838T, and 15376T were measured by real-time qPCR ( f ) and western blotting ( g ). P -value by one-way ANOVA with Tukey’s multiple comparison test. Representative of n = 3 independent experiments ( g ). h Orthotopic PDAC tumors generated with 14837T, 14838T, or 15376T were analyzed by Lin28b, α-SMA, and CK19 immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. i Lin28b high PDAC tumors were stained for Lin28b, Fap ( i ), and α-SMA ( j ) ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( f ). Data are shown as mean ± s.d.
Lin28b, supplied by WuXi AppTec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+antibodies+for+lin28b/pmc03059369-64-45-46?v=WuXi+AppTec
Average 90 stars, based on 1 article reviews
lin28b - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma shlin28b (knockdown of lin28b)
Primers used for qRT-PCR
Shlin28b (Knockdown Of Lin28b), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+antibodies+for+lin28b/pmc09278968-42-20-35?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
shlin28b (knockdown of lin28b) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

93
Proteintech lin28b
( A ) H&E and IHC of LIN28A and <t>LIN28B</t> of DEN-induced tumor nodules and adjacent tissue from mice treated with DEN for 8 months. Images are representative of 20 individual tumors. Scale bars: 50 μm. ( B ) Histology images show the normal liver architecture of control ( Tp53 fl/fl ), Tp53 -KO ( Albumin-Cre; Tp53 fl/fl ), and Lin28a/Lin28b/Tp53 -TKO ( Albumin-Cre; Tp53 fl/fl ; Lin28a fl/fl ; Lin28b fl/fl ) mice. Scale bar: 100 μm. ( C ) Representative gross images of WT, Tp53 -KO, and Lin28a/Lin28b/Tp53 -TKO livers treated with DEN for 8 months. Scale bar: 1 cm. ( D ) Surface tumor numbers from WT ( n = 14), Tp53 -KO ( n = 14), and Lin28a/Lin28b/Tp53 -TKO mice ( n = 8). Each dot represents 1 mouse. ( E ) This schematic shows DEN/CCl 4 and dox administration. Representative gross images of liver from control ( Cag-rtTA +/– ; Lin28a fl/fl ; Lin28b fl/fl ; n = 9) and Lin28a/Lin28b -DKO mice ( Cag-rtTA +/– ; TRE-Cre +/– ; Lin28a fl/fl ; Lin28b fl/fl ; n = 9) that were subjected to DEN/CCl 4 administration and dox water. Scale bars: 1 cm. All the images can also be found in . ( F and G ) Liver-to-body weight ratios (LW/BW) ( F ) and surface tumor numbers ( G ) of control ( n = 9) and Lin28a/Lin28b -DKO ( n = 9) mice. ( H ) Representative H&E images and LIN28B staining in tumors of control ( n = 9) and Lin28a/Lin28b -DKO mice ( n = 9). NL, normal liver; T1, tumor number 1; T2, tumor number 2. * P < 0.05; ** P < 0.01.
Lin28b, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+antibodies+for+lin28b/pmc11290964-219-13-14?v=Proteintech
Average 93 stars, based on 1 article reviews
lin28b - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Addgene inc pfrt flag ha dest lin28b plasmid
<t>LIN28B</t> is predominant LIN28 paralog expressed in human placenta. A, B) qPCR analysis of LIN28A and LIN28B mRNA expression in term human placenta (A) and isolated primary DCs, CTs, and STs (B) normalized to GAPDH. C–E) Representative LIN28B immunohistochemistry images in term human placenta of invasive trophoblasts (C), villous trophoblasts (D), and nonimmune rabbit IgG–only control (E). F) In situ protein LIN28B expression in DCs, CTs, and STs of placentas from normotensive pregnancies. Scale bars, 35 μm; n = 10 placental sections (F). Results represent means ± sem. *P < 0.05 vs. LIN28A (A, B) vs. DC (F).
Pfrt Flag Ha Dest Lin28b Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+antibodies+for+lin28b/pmc06338627-90-10-26?v=Addgene+inc
Average 90 stars, based on 1 article reviews
pfrt flag ha dest lin28b plasmid - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

93
Proteintech anti mouse lin28b
Aberrant <t>LIN28B</t> expression and DNA repair pathway are associate with MSE. (a) Integrated analysis combining scRNA‐seq data from ascites in a constructed preclinical OC model; scRNA‐seq data from MA in OC patients ( n = 13), and gene mutation profiles from MSE in cancer patients ( n = 442) to explore novel dual‐targeting therapeutic strategies (created at BioRender.com). (b) Venn diagram analysis of DEG targets between the preclinical OC model and OC patients (Nat Cancer. 2023). GO‐BP enrichment analysis for (c) SNV gene mutations and (d) CNV gene mutations in MSE from cancer patients. (e) Waterfall plot for top 45 SNV genes and relative pathways. Genotype Quality (GQ): Minimum threshold of 20 (99% confidence in the genotype call). Read Depth (DP): Site‐specific depth filters (DP ≥ 10 for high‐confidence calls, adjusted for cohort mean depth). lternate Allele Support: Minimum alternative allele reads (≥ 3) and fraction (AF ≥ 0.25 for heterozygous germline calls). opulation Frequency: Filtering against population databases (gnomAD allele frequency < 0.01 for rare variants, < 0.001 for ultra‐rare). (f) Heatmap of CNV genes in MSE from cancer patients ( n = 442). Quality Metrics: Segment‐wise log2 ratio standard deviation or confidence score (e.g., CNVkit quality score > 0.5). Size Threshold: Typically, > 1 kb for targeted sequencing and > 10–50 kb for whole‐genome sequencing to exclude small, noisy calls. Copy State Threshold: Log2 ratio thresholds define copy states (e.g., deletion: log2 ratio < −0.4, duplication: log2 ratio > 0.2).
Anti Mouse Lin28b, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+antibodies+for+lin28b/pmc13042977-210-12-14?v=Proteintech
Average 93 stars, based on 1 article reviews
anti mouse lin28b - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology anti lin28b
Aberrant <t>LIN28B</t> expression and DNA repair pathway are associate with MSE. (a) Integrated analysis combining scRNA‐seq data from ascites in a constructed preclinical OC model; scRNA‐seq data from MA in OC patients ( n = 13), and gene mutation profiles from MSE in cancer patients ( n = 442) to explore novel dual‐targeting therapeutic strategies (created at BioRender.com). (b) Venn diagram analysis of DEG targets between the preclinical OC model and OC patients (Nat Cancer. 2023). GO‐BP enrichment analysis for (c) SNV gene mutations and (d) CNV gene mutations in MSE from cancer patients. (e) Waterfall plot for top 45 SNV genes and relative pathways. Genotype Quality (GQ): Minimum threshold of 20 (99% confidence in the genotype call). Read Depth (DP): Site‐specific depth filters (DP ≥ 10 for high‐confidence calls, adjusted for cohort mean depth). lternate Allele Support: Minimum alternative allele reads (≥ 3) and fraction (AF ≥ 0.25 for heterozygous germline calls). opulation Frequency: Filtering against population databases (gnomAD allele frequency < 0.01 for rare variants, < 0.001 for ultra‐rare). (f) Heatmap of CNV genes in MSE from cancer patients ( n = 442). Quality Metrics: Segment‐wise log2 ratio standard deviation or confidence score (e.g., CNVkit quality score > 0.5). Size Threshold: Typically, > 1 kb for targeted sequencing and > 10–50 kb for whole‐genome sequencing to exclude small, noisy calls. Copy State Threshold: Log2 ratio thresholds define copy states (e.g., deletion: log2 ratio < −0.4, duplication: log2 ratio > 0.2).
Anti Lin28b, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+antibodies+for+lin28b/pmc08113855-54-9-10?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
anti lin28b - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
DOLANG Technology sheep lin28b promoter
Aberrant <t>LIN28B</t> expression and DNA repair pathway are associate with MSE. (a) Integrated analysis combining scRNA‐seq data from ascites in a constructed preclinical OC model; scRNA‐seq data from MA in OC patients ( n = 13), and gene mutation profiles from MSE in cancer patients ( n = 442) to explore novel dual‐targeting therapeutic strategies (created at BioRender.com). (b) Venn diagram analysis of DEG targets between the preclinical OC model and OC patients (Nat Cancer. 2023). GO‐BP enrichment analysis for (c) SNV gene mutations and (d) CNV gene mutations in MSE from cancer patients. (e) Waterfall plot for top 45 SNV genes and relative pathways. Genotype Quality (GQ): Minimum threshold of 20 (99% confidence in the genotype call). Read Depth (DP): Site‐specific depth filters (DP ≥ 10 for high‐confidence calls, adjusted for cohort mean depth). lternate Allele Support: Minimum alternative allele reads (≥ 3) and fraction (AF ≥ 0.25 for heterozygous germline calls). opulation Frequency: Filtering against population databases (gnomAD allele frequency < 0.01 for rare variants, < 0.001 for ultra‐rare). (f) Heatmap of CNV genes in MSE from cancer patients ( n = 442). Quality Metrics: Segment‐wise log2 ratio standard deviation or confidence score (e.g., CNVkit quality score > 0.5). Size Threshold: Typically, > 1 kb for targeted sequencing and > 10–50 kb for whole‐genome sequencing to exclude small, noisy calls. Copy State Threshold: Log2 ratio thresholds define copy states (e.g., deletion: log2 ratio < −0.4, duplication: log2 ratio > 0.2).
Sheep Lin28b Promoter, supplied by DOLANG Technology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+antibodies+for+lin28b/pm37239408-97-8-7?v=DOLANG+Technology
Average 90 stars, based on 1 article reviews
sheep lin28b promoter - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Cayman Chemical lin28b 1632
Aberrant <t>LIN28B</t> expression and DNA repair pathway are associate with MSE. (a) Integrated analysis combining scRNA‐seq data from ascites in a constructed preclinical OC model; scRNA‐seq data from MA in OC patients ( n = 13), and gene mutation profiles from MSE in cancer patients ( n = 442) to explore novel dual‐targeting therapeutic strategies (created at BioRender.com). (b) Venn diagram analysis of DEG targets between the preclinical OC model and OC patients (Nat Cancer. 2023). GO‐BP enrichment analysis for (c) SNV gene mutations and (d) CNV gene mutations in MSE from cancer patients. (e) Waterfall plot for top 45 SNV genes and relative pathways. Genotype Quality (GQ): Minimum threshold of 20 (99% confidence in the genotype call). Read Depth (DP): Site‐specific depth filters (DP ≥ 10 for high‐confidence calls, adjusted for cohort mean depth). lternate Allele Support: Minimum alternative allele reads (≥ 3) and fraction (AF ≥ 0.25 for heterozygous germline calls). opulation Frequency: Filtering against population databases (gnomAD allele frequency < 0.01 for rare variants, < 0.001 for ultra‐rare). (f) Heatmap of CNV genes in MSE from cancer patients ( n = 442). Quality Metrics: Segment‐wise log2 ratio standard deviation or confidence score (e.g., CNVkit quality score > 0.5). Size Threshold: Typically, > 1 kb for targeted sequencing and > 10–50 kb for whole‐genome sequencing to exclude small, noisy calls. Copy State Threshold: Log2 ratio thresholds define copy states (e.g., deletion: log2 ratio < −0.4, duplication: log2 ratio > 0.2).
Lin28b 1632, supplied by Cayman Chemical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primary+antibodies+for+lin28b/pm37341142-86-2-4?v=Cayman+Chemical
Average 90 stars, based on 1 article reviews
lin28b 1632 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


a IHC was performed on a PDAC patient TMA with LIN28B antibody. High expression of LIN28B (LIN28B high ) and low expression of LIN28B (LIN28B low ) in tissues was shown. Scale bar: 30 μm. b Survival curves for PDAC patients with high (red) or low (blue) levels of LIN28B. Statistical analysis was performed using two-sided Gehan-Breslow-Wilcoxon test; P = 0.0139; n = 80 patients. c Percentages of total population of patients ( n = 80) or of patients at each pathological stage (stage I; n = 35, stage II; n = 20, stage III; n = 12, stage IV; n = 13) and histological T status (T1; n = 13, T2; n = 42, T3-4; n = 25) expressing high (red) or low (blue) levels of LIN28B. d Correlation between LIN28B IHC scores in stroma and tumors (Pearson product-moment correlation test; r = 0.9962, p < 0.001). e Immunofluorescence was performed on the PDAC patient TMA using LIN28B, α-SMA, and CK19 antibodies. Representative images from LIN28B high hPDAC and LIN28B low hPDAC were shown. Scale bar: 30 μm. f , g The levels of Lin28b in 14837T, 14838T, and 15376T were measured by real-time qPCR ( f ) and western blotting ( g ). P -value by one-way ANOVA with Tukey’s multiple comparison test. Representative of n = 3 independent experiments ( g ). h Orthotopic PDAC tumors generated with 14837T, 14838T, or 15376T were analyzed by Lin28b, α-SMA, and CK19 immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. i Lin28b high PDAC tumors were stained for Lin28b, Fap ( i ), and α-SMA ( j ) ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( f ). Data are shown as mean ± s.d.

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: a IHC was performed on a PDAC patient TMA with LIN28B antibody. High expression of LIN28B (LIN28B high ) and low expression of LIN28B (LIN28B low ) in tissues was shown. Scale bar: 30 μm. b Survival curves for PDAC patients with high (red) or low (blue) levels of LIN28B. Statistical analysis was performed using two-sided Gehan-Breslow-Wilcoxon test; P = 0.0139; n = 80 patients. c Percentages of total population of patients ( n = 80) or of patients at each pathological stage (stage I; n = 35, stage II; n = 20, stage III; n = 12, stage IV; n = 13) and histological T status (T1; n = 13, T2; n = 42, T3-4; n = 25) expressing high (red) or low (blue) levels of LIN28B. d Correlation between LIN28B IHC scores in stroma and tumors (Pearson product-moment correlation test; r = 0.9962, p < 0.001). e Immunofluorescence was performed on the PDAC patient TMA using LIN28B, α-SMA, and CK19 antibodies. Representative images from LIN28B high hPDAC and LIN28B low hPDAC were shown. Scale bar: 30 μm. f , g The levels of Lin28b in 14837T, 14838T, and 15376T were measured by real-time qPCR ( f ) and western blotting ( g ). P -value by one-way ANOVA with Tukey’s multiple comparison test. Representative of n = 3 independent experiments ( g ). h Orthotopic PDAC tumors generated with 14837T, 14838T, or 15376T were analyzed by Lin28b, α-SMA, and CK19 immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. i Lin28b high PDAC tumors were stained for Lin28b, Fap ( i ), and α-SMA ( j ) ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( f ). Data are shown as mean ± s.d.

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Expressing, Immunofluorescence, Western Blot, Comparison, Generated, Staining

a , b Real-time qPCR analysis ( a ) and western blotting analysis ( b ) for Lin28b expression in mCAFs cultured alone or co-cultured with indicated tumor cells. Representative of n = 3 independent experiments ( b ). c , d 14837CAFs were direct co-cultured with 14837T or 15376T for six days and then sorted by flow cytometric cell sorting (FACS) ( c ). The levels of Lin28b were measured by real-time qPCR ( d ). e – j 14837CAFs ( e – g ) or 15376CAFs ( h – j ) were ‍cultured with 15376T-CM for up to 6 days. CM was derived from 15376T with low density (30–40%) or high density (80–90%). Cells were collected for real-‍time qPCR ( e , h ) and Western blotting ( f , g , i , j ) at indicated time points. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( f , g , i , j ). k , l 14837CAFs ( k ) or 15376CAFs ( l ) ‍were cultured with 15376T-CM or Lin28b-KO 15376T-‍CM for 6 days. Then, Lin28b levels were measured by western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. m , n The levels of LIN28B in human PDAC cell lines were measured by real-time qPCR ( m ) and western blotting ( n ). Representative of n = 3 independent experiments ( n ). o human CAFs (hCAFs) were cultured with CM from human PDAC cell lines for 6 days. Then, LIN28B levels were measured by western blotting. Representative of n = 3 independent experiments ( p – r ) hCAFs were cultured with PANC-1-CM ( p ), LIN28B-KO PANC-1-CM ( p ), PANC03.27-CM ( q ), LIN28B-KO PANC03.27-CM ( q ), hPDAC1 # -CM ( r ), and LIN28B-KO hPDAC1 # -CM ( r ) for 6 days. Then, the levels of LIN28B were measured by western blotting. LIN28B levels in PANC-1 ( p ), PANC03.27 ( q ), and hPDAC1 # ( r ) were included as a positive control. Representative of n = 3 independent experiments. s Orthotopic PDAC tumors generated with 15376T or Lin28b-KO 15376T were analyzed by Lin28b and α-SMA immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( a , d , e , h , m ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( a , e , h , m ) or two-tailed unpaired Student’s t-tests ( d ).

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: a , b Real-time qPCR analysis ( a ) and western blotting analysis ( b ) for Lin28b expression in mCAFs cultured alone or co-cultured with indicated tumor cells. Representative of n = 3 independent experiments ( b ). c , d 14837CAFs were direct co-cultured with 14837T or 15376T for six days and then sorted by flow cytometric cell sorting (FACS) ( c ). The levels of Lin28b were measured by real-time qPCR ( d ). e – j 14837CAFs ( e – g ) or 15376CAFs ( h – j ) were ‍cultured with 15376T-CM for up to 6 days. CM was derived from 15376T with low density (30–40%) or high density (80–90%). Cells were collected for real-‍time qPCR ( e , h ) and Western blotting ( f , g , i , j ) at indicated time points. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( f , g , i , j ). k , l 14837CAFs ( k ) or 15376CAFs ( l ) ‍were cultured with 15376T-CM or Lin28b-KO 15376T-‍CM for 6 days. Then, Lin28b levels were measured by western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. m , n The levels of LIN28B in human PDAC cell lines were measured by real-time qPCR ( m ) and western blotting ( n ). Representative of n = 3 independent experiments ( n ). o human CAFs (hCAFs) were cultured with CM from human PDAC cell lines for 6 days. Then, LIN28B levels were measured by western blotting. Representative of n = 3 independent experiments ( p – r ) hCAFs were cultured with PANC-1-CM ( p ), LIN28B-KO PANC-1-CM ( p ), PANC03.27-CM ( q ), LIN28B-KO PANC03.27-CM ( q ), hPDAC1 # -CM ( r ), and LIN28B-KO hPDAC1 # -CM ( r ) for 6 days. Then, the levels of LIN28B were measured by western blotting. LIN28B levels in PANC-1 ( p ), PANC03.27 ( q ), and hPDAC1 # ( r ) were included as a positive control. Representative of n = 3 independent experiments. s Orthotopic PDAC tumors generated with 15376T or Lin28b-KO 15376T were analyzed by Lin28b and α-SMA immunofluorescence staining ( n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( a , d , e , h , m ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( a , e , h , m ) or two-tailed unpaired Student’s t-tests ( d ).

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Western Blot, Expressing, Cell Culture, FACS, Derivative Assay, Positive Control, Generated, Immunofluorescence, Staining, Comparison, Two Tailed Test

a Venn diagram of genes upregulated in 15376T compared with Lin28b-KO 15376T and 14837T as determined by RNA-sequencing (RNA-seq). b , c The levels of Wnt5a in 15376T, Lin28b-KO 15376T, and 14837T were measured by real-‍time qPCR ( b ) and western blotting ( c ). Representative of n = 3 independent experiments ( c ). d , e The levels of WNT5A in PANC-1, LIN28B-KO PANC-1, and Mia Paca-2 were measured by real-‍time qPCR ( d ) and western blotting ( e ). Representative of n = 3 independent experiments ( e ). f Wnt5a levels in the supernatants of 15376T, Lin28b-KO 15376T, and 14837T were examined by ELISA. g WNT5A levels in the supernatants of PANC-1, LIN28B-KO PANC-1 and Mia Paca-2 were examined by ELISA. h , i 14837CAFs ( h ) or 15376CAFs ( i ) ‍were cultured with 15376T-CM or Wnt5a-KO 15376T-CM for 6 days. Then, Lin28b levels were measured by western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. j – l hCAFs were cultured with PANC-1-CM ( j ), WNT5A-KO PANC-1-CM ( j ), PANC03.27-CM ( k ), WNT5A-KO PANC03.27-CM ( k ), hPDAC1 # -CM ( l ), and WNT5A-KO hPDAC1 # -CM ( l ) for 6 days. Then, the levels of LIN28B were measured by western blotting. LIN28B levels in PANC-1 ( j ), PANC03.27 ( k ), and hPDAC1 # ( l ) were included as a positive control. Representative of n = 3 independent experiments. m Wnt5a levels in the supernatants of low (30–40%) and high (80–90%) density inoculated 15376T were examined by ELISA. n – q 14837CAFs ( n , o ) or 15376CAFs ( p , q ) were ‍treated with 100 ng/ml or 200 ng/ml recombinant-Wnt5a(r-mWnt5a) for 6 days. Cells were collected for Western blotting at indicated time points. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( n – q ). r , s 14837CAFs ( r ) or 15376CAFs ( s ) were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 1 μg/ml Wnt5a neutralizing antibody (anti-Wnt5a) for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( r , s ). t Orthotopic PDAC tumors generated with 15376T or Wnt5a-KO 15376T were analyzed by Wnt5a, Lin28b and α-SMA immunofluorescence staining (n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( b , d , f , g , m ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( b , d , f , g ) or two-tailed unpaired Student’s t-tests ( m ).

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: a Venn diagram of genes upregulated in 15376T compared with Lin28b-KO 15376T and 14837T as determined by RNA-sequencing (RNA-seq). b , c The levels of Wnt5a in 15376T, Lin28b-KO 15376T, and 14837T were measured by real-‍time qPCR ( b ) and western blotting ( c ). Representative of n = 3 independent experiments ( c ). d , e The levels of WNT5A in PANC-1, LIN28B-KO PANC-1, and Mia Paca-2 were measured by real-‍time qPCR ( d ) and western blotting ( e ). Representative of n = 3 independent experiments ( e ). f Wnt5a levels in the supernatants of 15376T, Lin28b-KO 15376T, and 14837T were examined by ELISA. g WNT5A levels in the supernatants of PANC-1, LIN28B-KO PANC-1 and Mia Paca-2 were examined by ELISA. h , i 14837CAFs ( h ) or 15376CAFs ( i ) ‍were cultured with 15376T-CM or Wnt5a-KO 15376T-CM for 6 days. Then, Lin28b levels were measured by western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. j – l hCAFs were cultured with PANC-1-CM ( j ), WNT5A-KO PANC-1-CM ( j ), PANC03.27-CM ( k ), WNT5A-KO PANC03.27-CM ( k ), hPDAC1 # -CM ( l ), and WNT5A-KO hPDAC1 # -CM ( l ) for 6 days. Then, the levels of LIN28B were measured by western blotting. LIN28B levels in PANC-1 ( j ), PANC03.27 ( k ), and hPDAC1 # ( l ) were included as a positive control. Representative of n = 3 independent experiments. m Wnt5a levels in the supernatants of low (30–40%) and high (80–90%) density inoculated 15376T were examined by ELISA. n – q 14837CAFs ( n , o ) or 15376CAFs ( p , q ) were ‍treated with 100 ng/ml or 200 ng/ml recombinant-Wnt5a(r-mWnt5a) for 6 days. Cells were collected for Western blotting at indicated time points. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( n – q ). r , s 14837CAFs ( r ) or 15376CAFs ( s ) were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 1 μg/ml Wnt5a neutralizing antibody (anti-Wnt5a) for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( r , s ). t Orthotopic PDAC tumors generated with 15376T or Wnt5a-KO 15376T were analyzed by Wnt5a, Lin28b and α-SMA immunofluorescence staining (n = 6 mice). Representative images are shown. Scale bar: 30 μm. Three biologically independent experiments were performed ( b , d , f , g , m ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( b , d , f , g ) or two-tailed unpaired Student’s t-tests ( m ).

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: RNA Sequencing Assay, Western Blot, Enzyme-linked Immunosorbent Assay, Cell Culture, Positive Control, Recombinant, Generated, Immunofluorescence, Staining, Comparison, Two Tailed Test

a , b The mRNA levels of Lin28b, Wnt5a, and Fzd4 in indicated cells were measured by real-time qPCR. c , d 14837CAFs ( c ), Fzd4-KO 14837CAFs c , 15376CAFs and Fzd4-KO 15376CAFs ( d ) were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. e Fzd4-positive (Fzd4 + ) and Fzd4-negative (Fzd4 - ) CAFs from KPC mice were sorted by flow cytometry (FACS). Flow plots showing the gating strategy for sorting Fzd4 + and Fzd4 - CAFs from KPC tumors. f Fzd4 + CAFs and Fzd4 - CAFs were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. g , h 14837CAFs, Fzd4-KO 14837CAFs ( g ), 15376CAFs, and Fzd4-KO 15376CAFs ( h ) were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, the levels of β-catenin were measured by Western blotting. Representative of n = 3 independent experiments. i Fzd4 + CAFs and Fzd4 - CAFs were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, the levels of β-catenin were measured by Western blotting and quantification. Representative of n = 3 independent experiments. j A schematic illustration of the β-catenin binding sites in the Lin28b promoter. k , l 14837CAFs were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. ChIP experiments were performed using anti-β-catenin antibody. k, binding site 1; l, binding site 2. m The relative luciferase activity was analyzed after 14837CAFs were transfected with TCF/LEF reporter and pRL-TK vector and then cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 200 ng/ml r-mWnt5a for 3 days. n – r Western blotting was used to detect the knockdown efficiency of β-catenin in 14837CAFs ( n ) and 15376CAFs ( p ). Representative of n = 2 independent experiments. 14837CAFs and β-catenin-KD 14837CAFs ( o ), 15376CAFs and, and β-catenin-KD 15376CAFs ( q ) were cultured with 14837T-‍CM or 15376T-‍CM for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( o , q ). r , s Western blotting was used to detect the knockdown efficiency of β-catenin in hCAFs ( r ). Representative of n = 2 independent experiments. hCAFs and β-catenin-KD hCAFs were cultured with Mia Paca-2-‍CM or PANC-1-‍CM for 6 days. Then, cells were collected for Western blotting ( s ). Lin28b levels in PANC-1 were included as a positive control. Representative of n = 3 independent experiments ( s ). Three biologically independent experiments were performed ( a , b , i , k – m ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( a , b , i , k – m ).

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: a , b The mRNA levels of Lin28b, Wnt5a, and Fzd4 in indicated cells were measured by real-time qPCR. c , d 14837CAFs ( c ), Fzd4-KO 14837CAFs c , 15376CAFs and Fzd4-KO 15376CAFs ( d ) were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. e Fzd4-positive (Fzd4 + ) and Fzd4-negative (Fzd4 - ) CAFs from KPC mice were sorted by flow cytometry (FACS). Flow plots showing the gating strategy for sorting Fzd4 + and Fzd4 - CAFs from KPC tumors. f Fzd4 + CAFs and Fzd4 - CAFs were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments. g , h 14837CAFs, Fzd4-KO 14837CAFs ( g ), 15376CAFs, and Fzd4-KO 15376CAFs ( h ) were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, the levels of β-catenin were measured by Western blotting. Representative of n = 3 independent experiments. i Fzd4 + CAFs and Fzd4 - CAFs were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. Then, the levels of β-catenin were measured by Western blotting and quantification. Representative of n = 3 independent experiments. j A schematic illustration of the β-catenin binding sites in the Lin28b promoter. k , l 14837CAFs were cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 100 ng/ml r-mWnt5a for 6 days. ChIP experiments were performed using anti-β-catenin antibody. k, binding site 1; l, binding site 2. m The relative luciferase activity was analyzed after 14837CAFs were transfected with TCF/LEF reporter and pRL-TK vector and then cultured with 14837T-‍CM or 15376T-‍CM in the presence or absence of 200 ng/ml r-mWnt5a for 3 days. n – r Western blotting was used to detect the knockdown efficiency of β-catenin in 14837CAFs ( n ) and 15376CAFs ( p ). Representative of n = 2 independent experiments. 14837CAFs and β-catenin-KD 14837CAFs ( o ), 15376CAFs and, and β-catenin-KD 15376CAFs ( q ) were cultured with 14837T-‍CM or 15376T-‍CM for 6 days. Then, cells were collected for Western blotting. Lin28b levels in 15376T were included as a positive control. Representative of n = 3 independent experiments ( o , q ). r , s Western blotting was used to detect the knockdown efficiency of β-catenin in hCAFs ( r ). Representative of n = 2 independent experiments. hCAFs and β-catenin-KD hCAFs were cultured with Mia Paca-2-‍CM or PANC-1-‍CM for 6 days. Then, cells were collected for Western blotting ( s ). Lin28b levels in PANC-1 were included as a positive control. Representative of n = 3 independent experiments ( s ). Three biologically independent experiments were performed ( a , b , i , k – m ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( a , b , i , k – m ).

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Cell Culture, Western Blot, Positive Control, Flow Cytometry, Binding Assay, Luciferase, Activity Assay, Transfection, Plasmid Preparation, Comparison

Before the experiment started, CAFs were cultured with 15376T-‍CM for 6 days to induce Lin28b expression. CM for CAFs culture was replaced daily ( a , b , e – h , k – p ). a 15376T were co-cultured with or without 15376CAFs in transwell chambers and treated with complete media (25 mM glucose) or glucose-limited medium (2 mM glucose) for 2 days. The cells were counted to calculate the cell proliferation. b Tumors were co-cultured with 15376CAFs or Lin28b-KO 15376CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. c , d Lin28b-WT was stable expressed in 14837CAFs ( c ) and 15376CAFs ( d ). Tumors were co-cultured with 14837CAFs ( c ), Lin28b-WT-expressing 14837CAFs ( c ), 15376CAFs ( d ) or Lin28b-WT-expressing 15376CAFs ( d ) in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. e – g 15376T was orthotopically co-injected with 15376CAFs or Lin28b-KO 15376CAFs into C57BL/6J mice ( n = 6 mice). After 1 week, the pancreas was weighed ( e ) and analyzed by Ki-67 and CK19 IHC staining ( f ). Scale bar: 30 μM. The proportion of ki67-positive ( g ) cell was shown ( n = 10 views per group). Data are shown as mean ± s.d. h , i 14837T was orthotopically co-injected with or without 14837CAFs ( h ), Lin28b-WT-expressing 14837CAFs ( h ), 15376CAFs ( i ) or Lin28b-WT-expressing 15376CAFs ( i ) into C57BL/6J mice ( n = 6 mice). After 1 week, the pancreas was weighed. j Tumors were co-cultured with 15376CAFs or Fzd4-KO 15376CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. k Tumors were co-cultured with Fzd4 + CAFs or Fzd4 - CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. l – n 15376T was orthotopically co-injected with 15376CAFs or Fzd4-KO 15376CAFs into C57BL/6J mice ( n = 6 mice). After 1 week, the pancreas was weighed ( l ) and analyzed by Ki-67 and CK19 staining ( m ). Scale bar: 30 μM. The proportion of ki67-positive ( n ) cell was shown ( n = 10 views per group). o 15376T cells were orthotopically injected into WT or FSP-Cre;Lin28b fl/fl mice ( n = 6 mice). After 2 weeks, the tumors were analyzed by Lin28b and α-SMA immunofluorescence staining. Representative images are shown. Scale bar: 30 μM. p – r 15376T or Lin28b-KO 15376T were orthotopically injected into WT or FSP-Cre;Lin28b fl/fl mice ( n = 6 mice). After 2 weeks, the pancreas was weighed ( p ) and analyzed by Ki-67 and CK19 immunofluorescence staining ( q ). Scale bar: 30 μM. The proportion of ki67-positive ( r ) cell was shown ( n = 10 views per group). Four biologically independent experiments were performed ( a – d , j , k ). Data are shown as mean ± s.d. P -value were determined by one-way ANOVA with Tukey’s multiple comparison test ( a – d , h – k , p , r ) or two-tailed unpaired Student’s t-tests ( e , g , l , n ).

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: Before the experiment started, CAFs were cultured with 15376T-‍CM for 6 days to induce Lin28b expression. CM for CAFs culture was replaced daily ( a , b , e – h , k – p ). a 15376T were co-cultured with or without 15376CAFs in transwell chambers and treated with complete media (25 mM glucose) or glucose-limited medium (2 mM glucose) for 2 days. The cells were counted to calculate the cell proliferation. b Tumors were co-cultured with 15376CAFs or Lin28b-KO 15376CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. c , d Lin28b-WT was stable expressed in 14837CAFs ( c ) and 15376CAFs ( d ). Tumors were co-cultured with 14837CAFs ( c ), Lin28b-WT-expressing 14837CAFs ( c ), 15376CAFs ( d ) or Lin28b-WT-expressing 15376CAFs ( d ) in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. e – g 15376T was orthotopically co-injected with 15376CAFs or Lin28b-KO 15376CAFs into C57BL/6J mice ( n = 6 mice). After 1 week, the pancreas was weighed ( e ) and analyzed by Ki-67 and CK19 IHC staining ( f ). Scale bar: 30 μM. The proportion of ki67-positive ( g ) cell was shown ( n = 10 views per group). Data are shown as mean ± s.d. h , i 14837T was orthotopically co-injected with or without 14837CAFs ( h ), Lin28b-WT-expressing 14837CAFs ( h ), 15376CAFs ( i ) or Lin28b-WT-expressing 15376CAFs ( i ) into C57BL/6J mice ( n = 6 mice). After 1 week, the pancreas was weighed. j Tumors were co-cultured with 15376CAFs or Fzd4-KO 15376CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. k Tumors were co-cultured with Fzd4 + CAFs or Fzd4 - CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation. l – n 15376T was orthotopically co-injected with 15376CAFs or Fzd4-KO 15376CAFs into C57BL/6J mice ( n = 6 mice). After 1 week, the pancreas was weighed ( l ) and analyzed by Ki-67 and CK19 staining ( m ). Scale bar: 30 μM. The proportion of ki67-positive ( n ) cell was shown ( n = 10 views per group). o 15376T cells were orthotopically injected into WT or FSP-Cre;Lin28b fl/fl mice ( n = 6 mice). After 2 weeks, the tumors were analyzed by Lin28b and α-SMA immunofluorescence staining. Representative images are shown. Scale bar: 30 μM. p – r 15376T or Lin28b-KO 15376T were orthotopically injected into WT or FSP-Cre;Lin28b fl/fl mice ( n = 6 mice). After 2 weeks, the pancreas was weighed ( p ) and analyzed by Ki-67 and CK19 immunofluorescence staining ( q ). Scale bar: 30 μM. The proportion of ki67-positive ( r ) cell was shown ( n = 10 views per group). Four biologically independent experiments were performed ( a – d , j , k ). Data are shown as mean ± s.d. P -value were determined by one-way ANOVA with Tukey’s multiple comparison test ( a – d , h – k , p , r ) or two-tailed unpaired Student’s t-tests ( e , g , l , n ).

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Cell Culture, Expressing, Injection, Immunohistochemistry, Staining, Immunofluorescence, Comparison, Two Tailed Test

Before the experiment started, CAFs were cultured with 15376T-‍CM for 6 days to induce Lin28b expression. CM for CAFs culture was replaced daily. a The ability of CAFs-CM to increase PDAC proliferation was abolished after boiling at 100 °C for 15 min as well as after three consecutive freeze (−80 °C, 10 min)-thaw (60 °C, 10 min) cycles. b The factor secreted by CAFs that increases PDAC proliferation was retained in the >3-kDa fraction of CAFs-CM. c CAFs were cultured with 15376T-‍CM for 6 days and then they were cultured with FBS-free 15376T-CM for 24 h. Then, CM from 15376CAFs or Lin28b-KO 15376CAFs were harvested for quantitative secretomics analysis. A heat map shows cytokines which are downregulated in Lin28b-KO 15376CAFs-CM. d , e CRISPR/Cas9-resistent flag-Lin28b-WT(r) and flag-Lin28b-MU(r) were overexpressed in Lin28b-KO CAFs. Western blotting was then performed to determine Lin28b protein levels ( d ). let-‍7 (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7i, mir-98) levels were measured by real-time qPCR ( e ). Representative of n = 3 independent experiments ( d ). f – j The levels of Clu ( f ), Cxcl5 ( g ), FN ( h ), PGRN ( i ), and Pcsk9 ( j ) in the supernatants of indicated cells were examined by ELISA. k 15376T were ‍treated with 100 ng/ml recombinant PGRN (r-mPGRN) or 100 ng/ml recombinant Pcsk9 (r-‍mPcsk9) under low glucose (2 mM) for 2 days. The cells were counted to calculate the cell proliferation. l 15376T were co-cultured with 15376CAFs in transwell chambers, and treated with or without 1 μg/ml neutralizing antibody (anti-Pcsk9 or anti-PGRN) under low glucose (2 mM) for 2 days. The cells were counted to calculate the cell proliferation. m , n Western blotting was used to detect the knocking-out efficiency of Pcsk9 in 15376CAFs ( m ). Representative of n = 2 independent experiments. 15376T were co-cultured with 15376CAFs or Pcsk9-KO 15376CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation ( n ). o – s 15376T was orthotopically co-injected with 15376CAFs or Pcsk9-KO 15376CAFs into C57BL/6 J mice and the tumors were harvested after 1 week ( n = 6 mice). IHC was performed with Pcsk9 and α-SMA antibodies ( o ) and Pcsk9 IHC scores in CAFs were plotted ( n = 10 views per group) ( p ). The pancreas was weighed ( q ) and analyzed by Ki-67 and CK19 IHC staining ( r ). The proportion of ki67-positive ( s ) cell was shown ( n = 10 views per group). Scale bar: 30 μM. ( t ) 15376T were orthotopically injected into C57BL/6 J mice. About 200 μg anti-Pcsk9 monoclonal antibodies (alirocumab) were intraperitoneally injected on days 3, 5, 8, and 11. After 2 weeks, the pancreas was weighed ( n = 6 mice). Three biologically independent experiments were performed ( e , f – j , t ). Four biologically independent experiments were performed ( a , b , k , l ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( a , b , e – l , n ) or two-tailed unpaired Student’s t-tests ( p , q , s , t ).

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: Before the experiment started, CAFs were cultured with 15376T-‍CM for 6 days to induce Lin28b expression. CM for CAFs culture was replaced daily. a The ability of CAFs-CM to increase PDAC proliferation was abolished after boiling at 100 °C for 15 min as well as after three consecutive freeze (−80 °C, 10 min)-thaw (60 °C, 10 min) cycles. b The factor secreted by CAFs that increases PDAC proliferation was retained in the >3-kDa fraction of CAFs-CM. c CAFs were cultured with 15376T-‍CM for 6 days and then they were cultured with FBS-free 15376T-CM for 24 h. Then, CM from 15376CAFs or Lin28b-KO 15376CAFs were harvested for quantitative secretomics analysis. A heat map shows cytokines which are downregulated in Lin28b-KO 15376CAFs-CM. d , e CRISPR/Cas9-resistent flag-Lin28b-WT(r) and flag-Lin28b-MU(r) were overexpressed in Lin28b-KO CAFs. Western blotting was then performed to determine Lin28b protein levels ( d ). let-‍7 (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7i, mir-98) levels were measured by real-time qPCR ( e ). Representative of n = 3 independent experiments ( d ). f – j The levels of Clu ( f ), Cxcl5 ( g ), FN ( h ), PGRN ( i ), and Pcsk9 ( j ) in the supernatants of indicated cells were examined by ELISA. k 15376T were ‍treated with 100 ng/ml recombinant PGRN (r-mPGRN) or 100 ng/ml recombinant Pcsk9 (r-‍mPcsk9) under low glucose (2 mM) for 2 days. The cells were counted to calculate the cell proliferation. l 15376T were co-cultured with 15376CAFs in transwell chambers, and treated with or without 1 μg/ml neutralizing antibody (anti-Pcsk9 or anti-PGRN) under low glucose (2 mM) for 2 days. The cells were counted to calculate the cell proliferation. m , n Western blotting was used to detect the knocking-out efficiency of Pcsk9 in 15376CAFs ( m ). Representative of n = 2 independent experiments. 15376T were co-cultured with 15376CAFs or Pcsk9-KO 15376CAFs in transwell chambers for 2 days. The cells were counted to calculate the cell proliferation ( n ). o – s 15376T was orthotopically co-injected with 15376CAFs or Pcsk9-KO 15376CAFs into C57BL/6 J mice and the tumors were harvested after 1 week ( n = 6 mice). IHC was performed with Pcsk9 and α-SMA antibodies ( o ) and Pcsk9 IHC scores in CAFs were plotted ( n = 10 views per group) ( p ). The pancreas was weighed ( q ) and analyzed by Ki-67 and CK19 IHC staining ( r ). The proportion of ki67-positive ( s ) cell was shown ( n = 10 views per group). Scale bar: 30 μM. ( t ) 15376T were orthotopically injected into C57BL/6 J mice. About 200 μg anti-Pcsk9 monoclonal antibodies (alirocumab) were intraperitoneally injected on days 3, 5, 8, and 11. After 2 weeks, the pancreas was weighed ( n = 6 mice). Three biologically independent experiments were performed ( e , f – j , t ). Four biologically independent experiments were performed ( a , b , k , l ). Data are shown as mean ± s.d. P -values were determined by one-way ANOVA with Tukey’s multiple comparison test ( a , b , e – l , n ) or two-tailed unpaired Student’s t-tests ( p , q , s , t ).

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Cell Culture, Expressing, CRISPR, Western Blot, Enzyme-linked Immunosorbent Assay, Recombinant, Injection, Immunohistochemistry, Comparison, Two Tailed Test

Before the experiment started, CAFs were cultured with 15376T-‍CM for 6 days to induce Lin28b expression. CM for CAFs culture was replaced daily ( d – j , m – p ). a – d 14837CAFs ( a , b ), Lin28b-WT-expressing 14837CAFs ( a , b ), 15376CAFs ( c , d ), and Lin28b-WT-expressing 15376CAFs ( c , d ) were ‍cultured under high glucose (25 mM) or low glucose (2 mM). The levels of Lin28b and Pcsk9 were measured by western blotting ( a , c ). The levels of Pcsk9 in the supernatants were examined by ELISA ( b , d ). Representative of n = 3 independent experiments ( a , c ). e , f 15376CAFs and Fzd4-KO 15376CAFs were ‍cultured under high glucose (25 mM) or low glucose (2 mM). The levels of Fzd4, Lin28b, and Pcsk9 were measured by western blotting ( e ). The levels of Pcsk9 in the supernatants were examined by ELISA ( f ). Representative of n = 3 independent experiments ( e ). g , h Fzd4 + CAFs and Fzd4 - CAFs were ‍cultured under high glucose (25 mM) or low glucose (2 mM). the levels of Fzd4, Lin28b, and Pcsk9 were measured by western blotting ( g ). The levels of Pcsk9 in the supernatants were examined by ELISA ( h ). Representative of n = 3 independent experiments ( g ). i The levels of Pcsk9 in 15376CAFs, Lin28b-KO 15376CAFs, flag-Lin28b-WT(r)-expressing 15376CAFs and flag-Lin28b-MU(r)-expressing 15376CAFs were measured by western blotting. Representative of n = 3 independent experiments. j 15376CAFs were transfected with let-7a agomir or let-7 sponge vector. The protein levels of Lin28b and Pcsk9 were measured by western blotting. Representative of n = 3 independent experiments. k , l Sequence alignment of the putative let-7a binding sites, and sketch of the construction of wild-type or mutant Pcsk9 3’UTR ( k ). The relative luciferase activity was analyzed after the pmir-‍GLO-Pcsk9 3’UTR (wild-type or mutant) vectors were co-transfected into 293T cells with let-‍7a agomir or agomir nc ( l ). P -value by one-way ANOVA with Tukey’s multiple comparison test. m , n The mRNA expression level ( m ) and mRNA stability ( n ) of Pcsk9 in 15376CAFs, Lin28b-KO 15376CAFs, flag-Lin28b-WT(r)-expressing 15376CAFs and flag-Lin28b-MU(r)-expressing 15376CAFs were measured by real-time qPCR. o , p 15376CAFs ( o ), Lin28b-KO 15376CAFs ( o ), flag-Lin28b-WT(r)-expressing 15376CAFs ( p ), and flag-Lin28b-MU(r)-expressing 15376CAFs ( p ) were collected and polysomes were fractionated on sucrose density gradients. Amount of Pcsk9 mRNA in various polysome fractions was analyzed by RT-PCR and normalized to 5S rRNA level. q , r 15376T cells were orthotopically injected into WT and FSP-Cre;Lin28b fl/fl mice. After 2 weeks, the tumors were analyzed by Pcsk9 and α-SMA IHC staining. Representative images are shown. Scale bar: 30 μM ( q ). Pcsk9 IHC scores in CAFs were plotted ( n = 10 views per group). Data are shown as mean±s.d. r Three biologically independent experiments were performed ( b , d , f , h , l – p ). Data are shown as mean ± s.d. P -value were determined by one-way ANOVA with Tukey’s multiple comparison test ( b , d , f , h , l – p ) or two-tailed unpaired Student’s t-tests ( r ).

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: Before the experiment started, CAFs were cultured with 15376T-‍CM for 6 days to induce Lin28b expression. CM for CAFs culture was replaced daily ( d – j , m – p ). a – d 14837CAFs ( a , b ), Lin28b-WT-expressing 14837CAFs ( a , b ), 15376CAFs ( c , d ), and Lin28b-WT-expressing 15376CAFs ( c , d ) were ‍cultured under high glucose (25 mM) or low glucose (2 mM). The levels of Lin28b and Pcsk9 were measured by western blotting ( a , c ). The levels of Pcsk9 in the supernatants were examined by ELISA ( b , d ). Representative of n = 3 independent experiments ( a , c ). e , f 15376CAFs and Fzd4-KO 15376CAFs were ‍cultured under high glucose (25 mM) or low glucose (2 mM). The levels of Fzd4, Lin28b, and Pcsk9 were measured by western blotting ( e ). The levels of Pcsk9 in the supernatants were examined by ELISA ( f ). Representative of n = 3 independent experiments ( e ). g , h Fzd4 + CAFs and Fzd4 - CAFs were ‍cultured under high glucose (25 mM) or low glucose (2 mM). the levels of Fzd4, Lin28b, and Pcsk9 were measured by western blotting ( g ). The levels of Pcsk9 in the supernatants were examined by ELISA ( h ). Representative of n = 3 independent experiments ( g ). i The levels of Pcsk9 in 15376CAFs, Lin28b-KO 15376CAFs, flag-Lin28b-WT(r)-expressing 15376CAFs and flag-Lin28b-MU(r)-expressing 15376CAFs were measured by western blotting. Representative of n = 3 independent experiments. j 15376CAFs were transfected with let-7a agomir or let-7 sponge vector. The protein levels of Lin28b and Pcsk9 were measured by western blotting. Representative of n = 3 independent experiments. k , l Sequence alignment of the putative let-7a binding sites, and sketch of the construction of wild-type or mutant Pcsk9 3’UTR ( k ). The relative luciferase activity was analyzed after the pmir-‍GLO-Pcsk9 3’UTR (wild-type or mutant) vectors were co-transfected into 293T cells with let-‍7a agomir or agomir nc ( l ). P -value by one-way ANOVA with Tukey’s multiple comparison test. m , n The mRNA expression level ( m ) and mRNA stability ( n ) of Pcsk9 in 15376CAFs, Lin28b-KO 15376CAFs, flag-Lin28b-WT(r)-expressing 15376CAFs and flag-Lin28b-MU(r)-expressing 15376CAFs were measured by real-time qPCR. o , p 15376CAFs ( o ), Lin28b-KO 15376CAFs ( o ), flag-Lin28b-WT(r)-expressing 15376CAFs ( p ), and flag-Lin28b-MU(r)-expressing 15376CAFs ( p ) were collected and polysomes were fractionated on sucrose density gradients. Amount of Pcsk9 mRNA in various polysome fractions was analyzed by RT-PCR and normalized to 5S rRNA level. q , r 15376T cells were orthotopically injected into WT and FSP-Cre;Lin28b fl/fl mice. After 2 weeks, the tumors were analyzed by Pcsk9 and α-SMA IHC staining. Representative images are shown. Scale bar: 30 μM ( q ). Pcsk9 IHC scores in CAFs were plotted ( n = 10 views per group). Data are shown as mean±s.d. r Three biologically independent experiments were performed ( b , d , f , h , l – p ). Data are shown as mean ± s.d. P -value were determined by one-way ANOVA with Tukey’s multiple comparison test ( b , d , f , h , l – p ) or two-tailed unpaired Student’s t-tests ( r ).

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Cell Culture, Expressing, Western Blot, Enzyme-linked Immunosorbent Assay, Transfection, Plasmid Preparation, Sequencing, Binding Assay, Mutagenesis, Luciferase, Activity Assay, Comparison, Reverse Transcription Polymerase Chain Reaction, Injection, Immunohistochemistry, Two Tailed Test

Model of positive feedback loop between Wnt5a and Lin28b in PDAC. Tumor-‍secreted Wnt5a activates Wnt–β-catenin signaling pathway, inducing Lin28b expression in CAFs. Up-regulation of Lin28b in CAFs increases PDAC survival though promoting pcsk9 secretion.

Journal: Nature Communications

Article Title: The Lin28b/Wnt5a axis drives pancreas cancer through crosstalk between cancer associated fibroblasts and tumor epithelium

doi: 10.1038/s41467-023-42508-8

Figure Lengend Snippet: Model of positive feedback loop between Wnt5a and Lin28b in PDAC. Tumor-‍secreted Wnt5a activates Wnt–β-catenin signaling pathway, inducing Lin28b expression in CAFs. Up-regulation of Lin28b in CAFs increases PDAC survival though promoting pcsk9 secretion.

Article Snippet: The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’.

Techniques: Expressing

Primers used for qRT-PCR

Journal: Bioengineered

Article Title: DOCK9 antisense RNA2 interacts with LIN28B to stabilize Wnt5a and boosts proliferation and migration of oxidized low densitylipoprotein-induced vascular smooth muscle cells

doi: 10.1080/21655979.2022.2033401

Figure Lengend Snippet: Primers used for qRT-PCR

Article Snippet: Short hairpin RNA negative control (shNC), short hairpin RNA targeting DOCK9-AS2 (shDOCK9-AS2; knockdown of lncRNA DOCK9-AS2), shWnt5a (knockdown of Wnt5a), shLIN28B (knockdown of LIN28B), pcDNA3.1 (empty vector), pc-Wnt5a (the overexpression vector of Wnt5a) obtained from Shanghai GenePharma Inc. VSMCs were seed in 6-well plates.

Techniques:

DOCK9-AS2 interact with Wnt5a by targeting LIN28B. (Figure 3a. A-G) The protein expression of EIF4A3, FBL, NCP56, FUS, IGF2BP3, LIN28, LIN28B in VSMCs treated with ox-LDL. (Figure 3b. A) The interaction between DOCK9-AS and LIN28, LIN28B and IGF2BP3 was assessed by biotinylated RNA pull down assay. (Figure 3b. B) The interaction between Wnt5a and LIN28, LIN28B and IGF2BP3 was assessed by biotinylated RNA pull down assay. (Figure 3b. C) The direct interaction between DOCK9-AS2 and LIN28B was measured by RIP. (Figure 3b. D) The direct interaction between Wnt5a and LIN28B was measured by RIP. (Figure 3b. E) The protein level of LIN28B and Wnt5a was observed upon sh-LIN28B transfection in ox-LDL-induced VSMCs. (Figure 3b. F) Wnt5a mRNA decay was observed upon knockdown of LIN28B group ** P < 0.01, *** P < 0.001 vs. the control group or Bio-NC group.

Journal: Bioengineered

Article Title: DOCK9 antisense RNA2 interacts with LIN28B to stabilize Wnt5a and boosts proliferation and migration of oxidized low densitylipoprotein-induced vascular smooth muscle cells

doi: 10.1080/21655979.2022.2033401

Figure Lengend Snippet: DOCK9-AS2 interact with Wnt5a by targeting LIN28B. (Figure 3a. A-G) The protein expression of EIF4A3, FBL, NCP56, FUS, IGF2BP3, LIN28, LIN28B in VSMCs treated with ox-LDL. (Figure 3b. A) The interaction between DOCK9-AS and LIN28, LIN28B and IGF2BP3 was assessed by biotinylated RNA pull down assay. (Figure 3b. B) The interaction between Wnt5a and LIN28, LIN28B and IGF2BP3 was assessed by biotinylated RNA pull down assay. (Figure 3b. C) The direct interaction between DOCK9-AS2 and LIN28B was measured by RIP. (Figure 3b. D) The direct interaction between Wnt5a and LIN28B was measured by RIP. (Figure 3b. E) The protein level of LIN28B and Wnt5a was observed upon sh-LIN28B transfection in ox-LDL-induced VSMCs. (Figure 3b. F) Wnt5a mRNA decay was observed upon knockdown of LIN28B group ** P < 0.01, *** P < 0.001 vs. the control group or Bio-NC group.

Article Snippet: Short hairpin RNA negative control (shNC), short hairpin RNA targeting DOCK9-AS2 (shDOCK9-AS2; knockdown of lncRNA DOCK9-AS2), shWnt5a (knockdown of Wnt5a), shLIN28B (knockdown of LIN28B), pcDNA3.1 (empty vector), pc-Wnt5a (the overexpression vector of Wnt5a) obtained from Shanghai GenePharma Inc. VSMCs were seed in 6-well plates.

Techniques: Expressing, Pull Down Assay, Transfection

Overexpression of Wnt5a reversed the reduced cell proliferation and migration induced by LIN28B knockdown. (Figure 4a. A) When ox-LDL-induced VSMCs were transfected with pc-Wnt5a or pcDNA3.1, the mRNA expression of Wnt5a was detected using qRT-PCR. ***p < 0.001. (Figure 4a. B) The ox-LDL-induced VSMCs were co-transfected with shLIN28B and pc-Wnt5a or pcDNA3.1, and the ability of cell proliferation was detected by CCK-8 assay. (Figure 4a. C-D) The expression of Ki67 was assessed by immunofluorescent staining. (Figure 4a. E-F) Cell migration was analyzed by transwell assay. (Figure 4b. A-D) The expression of E-Cadherin and N-Cadherin measured by immunofluorescent staining (nuclei were stained with DAPI; Magnification, x200). ** P < 0.01, *** P < 0.001 vs. the shNC group; # P < 0.05, ### P < 0.001 vs. shLIN28B + pcDNA3.1 group.

Journal: Bioengineered

Article Title: DOCK9 antisense RNA2 interacts with LIN28B to stabilize Wnt5a and boosts proliferation and migration of oxidized low densitylipoprotein-induced vascular smooth muscle cells

doi: 10.1080/21655979.2022.2033401

Figure Lengend Snippet: Overexpression of Wnt5a reversed the reduced cell proliferation and migration induced by LIN28B knockdown. (Figure 4a. A) When ox-LDL-induced VSMCs were transfected with pc-Wnt5a or pcDNA3.1, the mRNA expression of Wnt5a was detected using qRT-PCR. ***p < 0.001. (Figure 4a. B) The ox-LDL-induced VSMCs were co-transfected with shLIN28B and pc-Wnt5a or pcDNA3.1, and the ability of cell proliferation was detected by CCK-8 assay. (Figure 4a. C-D) The expression of Ki67 was assessed by immunofluorescent staining. (Figure 4a. E-F) Cell migration was analyzed by transwell assay. (Figure 4b. A-D) The expression of E-Cadherin and N-Cadherin measured by immunofluorescent staining (nuclei were stained with DAPI; Magnification, x200). ** P < 0.01, *** P < 0.001 vs. the shNC group; # P < 0.05, ### P < 0.001 vs. shLIN28B + pcDNA3.1 group.

Article Snippet: Short hairpin RNA negative control (shNC), short hairpin RNA targeting DOCK9-AS2 (shDOCK9-AS2; knockdown of lncRNA DOCK9-AS2), shWnt5a (knockdown of Wnt5a), shLIN28B (knockdown of LIN28B), pcDNA3.1 (empty vector), pc-Wnt5a (the overexpression vector of Wnt5a) obtained from Shanghai GenePharma Inc. VSMCs were seed in 6-well plates.

Techniques: Over Expression, Migration, Transfection, Expressing, Quantitative RT-PCR, CCK-8 Assay, Staining, Transwell Assay

( A ) H&E and IHC of LIN28A and LIN28B of DEN-induced tumor nodules and adjacent tissue from mice treated with DEN for 8 months. Images are representative of 20 individual tumors. Scale bars: 50 μm. ( B ) Histology images show the normal liver architecture of control ( Tp53 fl/fl ), Tp53 -KO ( Albumin-Cre; Tp53 fl/fl ), and Lin28a/Lin28b/Tp53 -TKO ( Albumin-Cre; Tp53 fl/fl ; Lin28a fl/fl ; Lin28b fl/fl ) mice. Scale bar: 100 μm. ( C ) Representative gross images of WT, Tp53 -KO, and Lin28a/Lin28b/Tp53 -TKO livers treated with DEN for 8 months. Scale bar: 1 cm. ( D ) Surface tumor numbers from WT ( n = 14), Tp53 -KO ( n = 14), and Lin28a/Lin28b/Tp53 -TKO mice ( n = 8). Each dot represents 1 mouse. ( E ) This schematic shows DEN/CCl 4 and dox administration. Representative gross images of liver from control ( Cag-rtTA +/– ; Lin28a fl/fl ; Lin28b fl/fl ; n = 9) and Lin28a/Lin28b -DKO mice ( Cag-rtTA +/– ; TRE-Cre +/– ; Lin28a fl/fl ; Lin28b fl/fl ; n = 9) that were subjected to DEN/CCl 4 administration and dox water. Scale bars: 1 cm. All the images can also be found in . ( F and G ) Liver-to-body weight ratios (LW/BW) ( F ) and surface tumor numbers ( G ) of control ( n = 9) and Lin28a/Lin28b -DKO ( n = 9) mice. ( H ) Representative H&E images and LIN28B staining in tumors of control ( n = 9) and Lin28a/Lin28b -DKO mice ( n = 9). NL, normal liver; T1, tumor number 1; T2, tumor number 2. * P < 0.05; ** P < 0.01.

Journal: The Journal of Clinical Investigation

Article Title: Liver cancer initiation requires translational activation by an oncofetal regulon involving LIN28 proteins

doi: 10.1172/JCI165734

Figure Lengend Snippet: ( A ) H&E and IHC of LIN28A and LIN28B of DEN-induced tumor nodules and adjacent tissue from mice treated with DEN for 8 months. Images are representative of 20 individual tumors. Scale bars: 50 μm. ( B ) Histology images show the normal liver architecture of control ( Tp53 fl/fl ), Tp53 -KO ( Albumin-Cre; Tp53 fl/fl ), and Lin28a/Lin28b/Tp53 -TKO ( Albumin-Cre; Tp53 fl/fl ; Lin28a fl/fl ; Lin28b fl/fl ) mice. Scale bar: 100 μm. ( C ) Representative gross images of WT, Tp53 -KO, and Lin28a/Lin28b/Tp53 -TKO livers treated with DEN for 8 months. Scale bar: 1 cm. ( D ) Surface tumor numbers from WT ( n = 14), Tp53 -KO ( n = 14), and Lin28a/Lin28b/Tp53 -TKO mice ( n = 8). Each dot represents 1 mouse. ( E ) This schematic shows DEN/CCl 4 and dox administration. Representative gross images of liver from control ( Cag-rtTA +/– ; Lin28a fl/fl ; Lin28b fl/fl ; n = 9) and Lin28a/Lin28b -DKO mice ( Cag-rtTA +/– ; TRE-Cre +/– ; Lin28a fl/fl ; Lin28b fl/fl ; n = 9) that were subjected to DEN/CCl 4 administration and dox water. Scale bars: 1 cm. All the images can also be found in . ( F and G ) Liver-to-body weight ratios (LW/BW) ( F ) and surface tumor numbers ( G ) of control ( n = 9) and Lin28a/Lin28b -DKO ( n = 9) mice. ( H ) Representative H&E images and LIN28B staining in tumors of control ( n = 9) and Lin28a/Lin28b -DKO mice ( n = 9). NL, normal liver; T1, tumor number 1; T2, tumor number 2. * P < 0.05; ** P < 0.01.

Article Snippet: Antibodies used were as follows: NRAS (Abcam, AB77392, IHC), p-ERK (CST, 9101, IHC), LIN28B (Proteintech, 16178-1-AP or CST 5422, IHC and WB), LIN28A (CST, 8641, IHC), c-MYC (MilliporeSigma, M4439, IHC), RPS5 (Abcam, AB210745, WB), IGF2BP1 (Abcam, AB166798, IHC), IGF2BP2 (Abcam, AB124930, IHC), IGF2BP3 (Proteintech, 14642-1-AP, IHC), CK19 (DSHB, TROMA-III, IHC), EpCAM (CST, 14452, IHC), and β-actin (CST 4970, WB).

Techniques: Control, Staining

( A ) Schematic for HDT of transposons in Tp53 -KO and Lin28a/Lin28b/Tp53 -TKO mice. ( B ) Representative gross images (left) and liver-to-body weight ratios (right) of Tp53 -KO ( n = 14) and Lin28a/Lin28b/Tp53 -TKO ( n = 8) mice receiving transposons carrying NRAS G12V for 7 weeks (P105). Scale bars: 1 cm; 5 mm (right panels). ( C ) IHC shows NRAS and LIN28B expression in early lesions of Tp53 -KO and Lin28a/Lin28b/Tp53 -TKO mice that had NRAS G12V injected 2 weeks prior (P70). Scale bars: 50 μm. ( D ) Representative gross images (left) and liver-to-body weight ratios (right) of Tp53 -KO ( n = 7) and Lin28a/Lin28b/Tp53 -TKO ( n = 3) mice receiving transposons carrying AKT for 7 weeks (P105). Scale bars: 1 cm; 7.5 mm (right panels). ( E ) Representative gross images (left) and liver-to-body weight ratios (right) of Tp53 -KO ( n = 3) and Lin28a/Lin28b/Tp53 -TKO ( n = 3) mice receiving transposons carrying CTNNB1 N90 and YAP S137A for 7 weeks (P105). Scale bars: 1 cm; 5 mm (right panels). ** P < 0.01.

Journal: The Journal of Clinical Investigation

Article Title: Liver cancer initiation requires translational activation by an oncofetal regulon involving LIN28 proteins

doi: 10.1172/JCI165734

Figure Lengend Snippet: ( A ) Schematic for HDT of transposons in Tp53 -KO and Lin28a/Lin28b/Tp53 -TKO mice. ( B ) Representative gross images (left) and liver-to-body weight ratios (right) of Tp53 -KO ( n = 14) and Lin28a/Lin28b/Tp53 -TKO ( n = 8) mice receiving transposons carrying NRAS G12V for 7 weeks (P105). Scale bars: 1 cm; 5 mm (right panels). ( C ) IHC shows NRAS and LIN28B expression in early lesions of Tp53 -KO and Lin28a/Lin28b/Tp53 -TKO mice that had NRAS G12V injected 2 weeks prior (P70). Scale bars: 50 μm. ( D ) Representative gross images (left) and liver-to-body weight ratios (right) of Tp53 -KO ( n = 7) and Lin28a/Lin28b/Tp53 -TKO ( n = 3) mice receiving transposons carrying AKT for 7 weeks (P105). Scale bars: 1 cm; 7.5 mm (right panels). ( E ) Representative gross images (left) and liver-to-body weight ratios (right) of Tp53 -KO ( n = 3) and Lin28a/Lin28b/Tp53 -TKO ( n = 3) mice receiving transposons carrying CTNNB1 N90 and YAP S137A for 7 weeks (P105). Scale bars: 1 cm; 5 mm (right panels). ** P < 0.01.

Article Snippet: Antibodies used were as follows: NRAS (Abcam, AB77392, IHC), p-ERK (CST, 9101, IHC), LIN28B (Proteintech, 16178-1-AP or CST 5422, IHC and WB), LIN28A (CST, 8641, IHC), c-MYC (MilliporeSigma, M4439, IHC), RPS5 (Abcam, AB210745, WB), IGF2BP1 (Abcam, AB166798, IHC), IGF2BP2 (Abcam, AB124930, IHC), IGF2BP3 (Proteintech, 14642-1-AP, IHC), CK19 (DSHB, TROMA-III, IHC), EpCAM (CST, 14452, IHC), and β-actin (CST 4970, WB).

Techniques: Expressing, Injection

( A ) Representative gross images of Tp53-KO ( Albumin-Cre; Tp53 fl/fl ; n = 4), Lin28a/Tp53 -DKO ( Albumin-Cre ; Tp53 fl/fl ; Lin28a fl/fl ; n = 5), and Lin28b/Tp53 -DKO ( Albumin-Cre ; p53 fl/fl ; Lin28b fl/fl ; n = 4) mice that received NRAS G12V by HDT for 7 weeks. Scale bars: 1 cm; 5 mm (right panels). ( B ) Liver-to-body weight ratios for A . One-way ANOVA was performed. ( C ) Representative gross images of Lin28a/Lin28b/Tp53 -TKO mice that received NRAS G12V in combination with pT3-eGFP ( n = 5), pT3-LIN28A ( n = 8), or pT3-LIN28B ( n = 3) for 7 weeks. Scale bars: 1 cm; 5 mm (right panels). ( D ) Liver-to-body weight ratios for C . One-way ANOVA was performed. ( E ) Representative gross images of Lin28a/Lin28b/Tp53 -TKO mice that received NRAS G12V combined with pCMV-eGFP ( n = 4) or pCMV-LIN28B ( n = 4) for 7 weeks. Scale bars: 1 cm; 5 mm (right panels). ( F ) Liver-to-body weight ratios for E . ** P < 0.01; *** P < 0.001.

Journal: The Journal of Clinical Investigation

Article Title: Liver cancer initiation requires translational activation by an oncofetal regulon involving LIN28 proteins

doi: 10.1172/JCI165734

Figure Lengend Snippet: ( A ) Representative gross images of Tp53-KO ( Albumin-Cre; Tp53 fl/fl ; n = 4), Lin28a/Tp53 -DKO ( Albumin-Cre ; Tp53 fl/fl ; Lin28a fl/fl ; n = 5), and Lin28b/Tp53 -DKO ( Albumin-Cre ; p53 fl/fl ; Lin28b fl/fl ; n = 4) mice that received NRAS G12V by HDT for 7 weeks. Scale bars: 1 cm; 5 mm (right panels). ( B ) Liver-to-body weight ratios for A . One-way ANOVA was performed. ( C ) Representative gross images of Lin28a/Lin28b/Tp53 -TKO mice that received NRAS G12V in combination with pT3-eGFP ( n = 5), pT3-LIN28A ( n = 8), or pT3-LIN28B ( n = 3) for 7 weeks. Scale bars: 1 cm; 5 mm (right panels). ( D ) Liver-to-body weight ratios for C . One-way ANOVA was performed. ( E ) Representative gross images of Lin28a/Lin28b/Tp53 -TKO mice that received NRAS G12V combined with pCMV-eGFP ( n = 4) or pCMV-LIN28B ( n = 4) for 7 weeks. Scale bars: 1 cm; 5 mm (right panels). ( F ) Liver-to-body weight ratios for E . ** P < 0.01; *** P < 0.001.

Article Snippet: Antibodies used were as follows: NRAS (Abcam, AB77392, IHC), p-ERK (CST, 9101, IHC), LIN28B (Proteintech, 16178-1-AP or CST 5422, IHC and WB), LIN28A (CST, 8641, IHC), c-MYC (MilliporeSigma, M4439, IHC), RPS5 (Abcam, AB210745, WB), IGF2BP1 (Abcam, AB166798, IHC), IGF2BP2 (Abcam, AB124930, IHC), IGF2BP3 (Proteintech, 14642-1-AP, IHC), CK19 (DSHB, TROMA-III, IHC), EpCAM (CST, 14452, IHC), and β-actin (CST 4970, WB).

Techniques:

( A ) Venn diagram shows 15 factors that bind to LIN28 proteins as both proteins and mRNAs. See gene names in . ( B ) WB analysis shows LIN28B expression 48 hours after siRNA treatment in Huh7 cells. SE, short exposure; LE, long exposure. The numbers below the boxes show relative intensity. ( C ) Polysome profiling shows total translational activity in Huh7 cells with LIN28B siRNA knockdown compared with control siRNA–treated cells. The graph shows a representative profile from 3 replicate experiments. ( D ) RT-qPCR analysis of LIN28 targets show the percentage of active translating mRNA fraction in control and LIN28B knockdown Huh7 cells. Data include 3 biological replicates. * P < 0.05; ** P < 0.01.

Journal: The Journal of Clinical Investigation

Article Title: Liver cancer initiation requires translational activation by an oncofetal regulon involving LIN28 proteins

doi: 10.1172/JCI165734

Figure Lengend Snippet: ( A ) Venn diagram shows 15 factors that bind to LIN28 proteins as both proteins and mRNAs. See gene names in . ( B ) WB analysis shows LIN28B expression 48 hours after siRNA treatment in Huh7 cells. SE, short exposure; LE, long exposure. The numbers below the boxes show relative intensity. ( C ) Polysome profiling shows total translational activity in Huh7 cells with LIN28B siRNA knockdown compared with control siRNA–treated cells. The graph shows a representative profile from 3 replicate experiments. ( D ) RT-qPCR analysis of LIN28 targets show the percentage of active translating mRNA fraction in control and LIN28B knockdown Huh7 cells. Data include 3 biological replicates. * P < 0.05; ** P < 0.01.

Article Snippet: Antibodies used were as follows: NRAS (Abcam, AB77392, IHC), p-ERK (CST, 9101, IHC), LIN28B (Proteintech, 16178-1-AP or CST 5422, IHC and WB), LIN28A (CST, 8641, IHC), c-MYC (MilliporeSigma, M4439, IHC), RPS5 (Abcam, AB210745, WB), IGF2BP1 (Abcam, AB166798, IHC), IGF2BP2 (Abcam, AB124930, IHC), IGF2BP3 (Proteintech, 14642-1-AP, IHC), CK19 (DSHB, TROMA-III, IHC), EpCAM (CST, 14452, IHC), and β-actin (CST 4970, WB).

Techniques: Expressing, Activity Assay, Knockdown, Control, Quantitative RT-PCR

( A ) eCLIP data show LIN28B-binding regions on RPS5 mRNA. Red marks under the gene indicate the location of consensus LIN28B-binding motifs (GGAGA). Deletion (Δ) and mutation (MT) of consensus motifs were introduced to prevent LIN28B binding. Exon 1, 2, 3, and 3′ UTR sequences were inserted into the Renilla 3′ UTR region. ( B ) WB analysis of RPS5 and LIN28B in Huh7 and SNU308 cell lines. Numbers below the boxes show relative intensities. ( C ) Renilla luciferase activity promoted by RPS5 exon 1, exon 2, exon 3, and 3′ UTR reporters in LIN28B siRNA knockdown ( n = 3) versus control Huh7 cells ( n = 3). ( D ) Renilla luciferase activity promoted by RPS5 exon 1, exon 2, exon 3, and 3′ UTR reporters in LIN28B overexpression ( n = 3) versus control SNU308 cells ( n = 3). ( E and F ) Renilla luciferase activity promoted by WT RPS5 sequences compared with deletion and mutation containing reporters in control (blue) and LIN28B siRNA knockdown (red) Huh7 cells ( n = 3) ( E ) and in control overexpression (green) and LIN28B overexpression (orange) SNU308 cells ( n = 3) ( F ). One-way ANOVA was performed. ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Journal: The Journal of Clinical Investigation

Article Title: Liver cancer initiation requires translational activation by an oncofetal regulon involving LIN28 proteins

doi: 10.1172/JCI165734

Figure Lengend Snippet: ( A ) eCLIP data show LIN28B-binding regions on RPS5 mRNA. Red marks under the gene indicate the location of consensus LIN28B-binding motifs (GGAGA). Deletion (Δ) and mutation (MT) of consensus motifs were introduced to prevent LIN28B binding. Exon 1, 2, 3, and 3′ UTR sequences were inserted into the Renilla 3′ UTR region. ( B ) WB analysis of RPS5 and LIN28B in Huh7 and SNU308 cell lines. Numbers below the boxes show relative intensities. ( C ) Renilla luciferase activity promoted by RPS5 exon 1, exon 2, exon 3, and 3′ UTR reporters in LIN28B siRNA knockdown ( n = 3) versus control Huh7 cells ( n = 3). ( D ) Renilla luciferase activity promoted by RPS5 exon 1, exon 2, exon 3, and 3′ UTR reporters in LIN28B overexpression ( n = 3) versus control SNU308 cells ( n = 3). ( E and F ) Renilla luciferase activity promoted by WT RPS5 sequences compared with deletion and mutation containing reporters in control (blue) and LIN28B siRNA knockdown (red) Huh7 cells ( n = 3) ( E ) and in control overexpression (green) and LIN28B overexpression (orange) SNU308 cells ( n = 3) ( F ). One-way ANOVA was performed. ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Article Snippet: Antibodies used were as follows: NRAS (Abcam, AB77392, IHC), p-ERK (CST, 9101, IHC), LIN28B (Proteintech, 16178-1-AP or CST 5422, IHC and WB), LIN28A (CST, 8641, IHC), c-MYC (MilliporeSigma, M4439, IHC), RPS5 (Abcam, AB210745, WB), IGF2BP1 (Abcam, AB166798, IHC), IGF2BP2 (Abcam, AB124930, IHC), IGF2BP3 (Proteintech, 14642-1-AP, IHC), CK19 (DSHB, TROMA-III, IHC), EpCAM (CST, 14452, IHC), and β-actin (CST 4970, WB).

Techniques: Binding Assay, Mutagenesis, Luciferase, Activity Assay, Knockdown, Control, Over Expression

( A ) Representative gross images of Lin28a/Lin28b/Tp53 -TKO mice receiving NRAS G12V in combination with pT3-RBPs ( n > 3), pT3-eGFP ( n = 5), or pT3-Luciferase ( n = 5) for 7 weeks. Scale bars: 1 cm. All the images can also be found in . ( B ) Surface tumor number for A . One-way ANOVA was performed. ( C ) Liver-to-body weight ratios for A . One-way ANOVA was performed. ( D ) WB analysis quantified OP-puro labeling protein in Huh7 cells with Lin28b knockdown plus target overexpression. Number below the box shows relative intensity. ( E ) Representative gross images of Tp53 -KO ( Albumin-Cre; Tp53 fl/fl ; n = 5) and Lin28a/Lin28b/Tp53 -TKO ( Albumin-Cre ; Tp53 fl/fl ; Lin28a fl/fl ; Lin28b fl/fl ) mice that received NRAS G12V by HDT for 7 weeks. TKO mice were subjected to BAZ2A inhibitors ( n = 6) or DMSO ( n = 5) once per week starting 3 days after HDT. Scale bars: 1 cm. One-way ANOVA was performed. ( F ) Schematic shows the importance of LIN28 proteins for tumor initiation. The image was designed and drawn using BioRender. ** P < 0.01; **** P < 0.0001.

Journal: The Journal of Clinical Investigation

Article Title: Liver cancer initiation requires translational activation by an oncofetal regulon involving LIN28 proteins

doi: 10.1172/JCI165734

Figure Lengend Snippet: ( A ) Representative gross images of Lin28a/Lin28b/Tp53 -TKO mice receiving NRAS G12V in combination with pT3-RBPs ( n > 3), pT3-eGFP ( n = 5), or pT3-Luciferase ( n = 5) for 7 weeks. Scale bars: 1 cm. All the images can also be found in . ( B ) Surface tumor number for A . One-way ANOVA was performed. ( C ) Liver-to-body weight ratios for A . One-way ANOVA was performed. ( D ) WB analysis quantified OP-puro labeling protein in Huh7 cells with Lin28b knockdown plus target overexpression. Number below the box shows relative intensity. ( E ) Representative gross images of Tp53 -KO ( Albumin-Cre; Tp53 fl/fl ; n = 5) and Lin28a/Lin28b/Tp53 -TKO ( Albumin-Cre ; Tp53 fl/fl ; Lin28a fl/fl ; Lin28b fl/fl ) mice that received NRAS G12V by HDT for 7 weeks. TKO mice were subjected to BAZ2A inhibitors ( n = 6) or DMSO ( n = 5) once per week starting 3 days after HDT. Scale bars: 1 cm. One-way ANOVA was performed. ( F ) Schematic shows the importance of LIN28 proteins for tumor initiation. The image was designed and drawn using BioRender. ** P < 0.01; **** P < 0.0001.

Article Snippet: Antibodies used were as follows: NRAS (Abcam, AB77392, IHC), p-ERK (CST, 9101, IHC), LIN28B (Proteintech, 16178-1-AP or CST 5422, IHC and WB), LIN28A (CST, 8641, IHC), c-MYC (MilliporeSigma, M4439, IHC), RPS5 (Abcam, AB210745, WB), IGF2BP1 (Abcam, AB166798, IHC), IGF2BP2 (Abcam, AB124930, IHC), IGF2BP3 (Proteintech, 14642-1-AP, IHC), CK19 (DSHB, TROMA-III, IHC), EpCAM (CST, 14452, IHC), and β-actin (CST 4970, WB).

Techniques: Luciferase, Labeling, Knockdown, Over Expression

LIN28B is predominant LIN28 paralog expressed in human placenta. A, B) qPCR analysis of LIN28A and LIN28B mRNA expression in term human placenta (A) and isolated primary DCs, CTs, and STs (B) normalized to GAPDH. C–E) Representative LIN28B immunohistochemistry images in term human placenta of invasive trophoblasts (C), villous trophoblasts (D), and nonimmune rabbit IgG–only control (E). F) In situ protein LIN28B expression in DCs, CTs, and STs of placentas from normotensive pregnancies. Scale bars, 35 μm; n = 10 placental sections (F). Results represent means ± sem. *P < 0.05 vs. LIN28A (A, B) vs. DC (F).

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: LIN28B is predominant LIN28 paralog expressed in human placenta. A, B) qPCR analysis of LIN28A and LIN28B mRNA expression in term human placenta (A) and isolated primary DCs, CTs, and STs (B) normalized to GAPDH. C–E) Representative LIN28B immunohistochemistry images in term human placenta of invasive trophoblasts (C), villous trophoblasts (D), and nonimmune rabbit IgG–only control (E). F) In situ protein LIN28B expression in DCs, CTs, and STs of placentas from normotensive pregnancies. Scale bars, 35 μm; n = 10 placental sections (F). Results represent means ± sem. *P < 0.05 vs. LIN28A (A, B) vs. DC (F).

Article Snippet: HTR8/SVneo cells were transfected with green fluorescent protein (GFP) or pFRT/FLAG/HA-DEST LIN28B plasmid, a gift from T. Tuschl (The Rockefeller University, New York, NY, USA) (43798; Addgene, Cambridge, MA, USA) ( 29 ) using 25 kDa linear polyethylenimine (23966; Polysciences, Philadelphia, PA, USA).

Techniques: Expressing, Isolation, Immunohistochemistry, Control, In Situ

LIN28B is decreased in placenta of PE pregnancies. A–D) Representative images of LIN28B immunostaining of invasive trophoblasts (A, C) and villous trophoblasts (B, D) in placentas from normotensive pregnancies (A, B) and in preeclamptic (PE) placental tissues (C, D). Scale bars, 35 μm. E) Representative immunoblot for LIN28B and α-tubulin in term placenta lysates from 4 normotensive pregnancies vs. 4 PE pregnancies (top) and densitometric analysis of immunoblotting results for LIN28B normalized to α-tubulin from tissue lysates from normotensive pregnancies (n = 15) and PE pregnancies (n = 13) (bottom). F) qPCR analysis for LIN28B mRNA expression in placental lysates from normotensive pregnancies (n = 21) and from preeclamptic pregnancies (n = 19). G) Let-7g/LIN28B protein ratio determined by qPCR analysis for let-7g normalized to U18 and LIN28B immunoblot normalized to α-tubulin in placental lysates from normotensive pregnancies and PE pregnancies. Results represent means ± sem. *P < 0.05 vs. normal.

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: LIN28B is decreased in placenta of PE pregnancies. A–D) Representative images of LIN28B immunostaining of invasive trophoblasts (A, C) and villous trophoblasts (B, D) in placentas from normotensive pregnancies (A, B) and in preeclamptic (PE) placental tissues (C, D). Scale bars, 35 μm. E) Representative immunoblot for LIN28B and α-tubulin in term placenta lysates from 4 normotensive pregnancies vs. 4 PE pregnancies (top) and densitometric analysis of immunoblotting results for LIN28B normalized to α-tubulin from tissue lysates from normotensive pregnancies (n = 15) and PE pregnancies (n = 13) (bottom). F) qPCR analysis for LIN28B mRNA expression in placental lysates from normotensive pregnancies (n = 21) and from preeclamptic pregnancies (n = 19). G) Let-7g/LIN28B protein ratio determined by qPCR analysis for let-7g normalized to U18 and LIN28B immunoblot normalized to α-tubulin in placental lysates from normotensive pregnancies and PE pregnancies. Results represent means ± sem. *P < 0.05 vs. normal.

Article Snippet: HTR8/SVneo cells were transfected with green fluorescent protein (GFP) or pFRT/FLAG/HA-DEST LIN28B plasmid, a gift from T. Tuschl (The Rockefeller University, New York, NY, USA) (43798; Addgene, Cambridge, MA, USA) ( 29 ) using 25 kDa linear polyethylenimine (23966; Polysciences, Philadelphia, PA, USA).

Techniques: Immunostaining, Western Blot, Expressing

LIN28B is highly expressed in syncytial sprouts and invasive trophoblasts in first trimester placentas and increases trophoblast migration in vitro. A–C) Representative images of immunohistochemical staining for LIN28B in human first trimester placenta. LIN28B is highly expressed in syncytial sprouts of chorionic villi (black arrows, A). LIN28B expression increases from proximal EVTs (PEVTs) to distal invasive EVTs (DEVTs) in placental cell columns (B). LIN28B expression is lowest in PEVTs and increased in interstitial trophoblasts (black arrows) invading maternal decidua (red arrowheads) in anchoring villi (C). D) Representative serial section of tissue shown in C double immunostained for DC marker vimentin (pink) and trophoblast marker cytokeratin-7 (brown). Red arrowheads and black arrows in D correspond to red arrowheads and black arrows in C. E) Representative results of scratch wound assay at time of scratch application (top) and after 24 h (bottom) from HTR8/SVneo cells transfected with either GFP (control) or LIN28B. F) Quantification of migration after 24 h. Scale bars, 35 mm. Results represent means ± sem. *P < 0.05 vs. control.

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: LIN28B is highly expressed in syncytial sprouts and invasive trophoblasts in first trimester placentas and increases trophoblast migration in vitro. A–C) Representative images of immunohistochemical staining for LIN28B in human first trimester placenta. LIN28B is highly expressed in syncytial sprouts of chorionic villi (black arrows, A). LIN28B expression increases from proximal EVTs (PEVTs) to distal invasive EVTs (DEVTs) in placental cell columns (B). LIN28B expression is lowest in PEVTs and increased in interstitial trophoblasts (black arrows) invading maternal decidua (red arrowheads) in anchoring villi (C). D) Representative serial section of tissue shown in C double immunostained for DC marker vimentin (pink) and trophoblast marker cytokeratin-7 (brown). Red arrowheads and black arrows in D correspond to red arrowheads and black arrows in C. E) Representative results of scratch wound assay at time of scratch application (top) and after 24 h (bottom) from HTR8/SVneo cells transfected with either GFP (control) or LIN28B. F) Quantification of migration after 24 h. Scale bars, 35 mm. Results represent means ± sem. *P < 0.05 vs. control.

Article Snippet: HTR8/SVneo cells were transfected with green fluorescent protein (GFP) or pFRT/FLAG/HA-DEST LIN28B plasmid, a gift from T. Tuschl (The Rockefeller University, New York, NY, USA) (43798; Addgene, Cambridge, MA, USA) ( 29 ) using 25 kDa linear polyethylenimine (23966; Polysciences, Philadelphia, PA, USA).

Techniques: Migration, In Vitro, Immunohistochemical staining, Staining, Expressing, Marker, Scratch Wound Assay Assay, Transfection, Control

LIN28B regulates trophoblast proliferation, differentiation, inflammation, and C19MC miRNA expression. A) Representative immunoblot, densitometric quantification, and qPCR analysis of LIN28B levels 72 h after control or LIN28B shRNA-mediated knockdown in JEG3 cells. B, C) qPCR analysis of indicated gene (B) and miRNA (C), normalized to GAPDH and U18, respectively, after transient transfection of JEG3 cells with control or LIN28B shRNA. D) Representative immunoblot, densitometric quantification, and qPCR analysis of LIN28B levels 72 h after transient overexpression of GFP (control) or LIN28B encoding plasmids in HTR8/SVneo cells. E) qPCR analysis of indicated genes 72 h after transient overexpression of GFP or LIN28B in HTR8/SVneo cells. F) Cell proliferation analysis 72 h after transient knockdown of LIN28B in JEG3 cells or transient overexpression of LIN28B in HTR8/SVneo cells. Results represent means ± sem. *P < 0.05 shLIN28B vs. scrambled (A–C) or LIN28B vs. control (D, E).

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: LIN28B regulates trophoblast proliferation, differentiation, inflammation, and C19MC miRNA expression. A) Representative immunoblot, densitometric quantification, and qPCR analysis of LIN28B levels 72 h after control or LIN28B shRNA-mediated knockdown in JEG3 cells. B, C) qPCR analysis of indicated gene (B) and miRNA (C), normalized to GAPDH and U18, respectively, after transient transfection of JEG3 cells with control or LIN28B shRNA. D) Representative immunoblot, densitometric quantification, and qPCR analysis of LIN28B levels 72 h after transient overexpression of GFP (control) or LIN28B encoding plasmids in HTR8/SVneo cells. E) qPCR analysis of indicated genes 72 h after transient overexpression of GFP or LIN28B in HTR8/SVneo cells. F) Cell proliferation analysis 72 h after transient knockdown of LIN28B in JEG3 cells or transient overexpression of LIN28B in HTR8/SVneo cells. Results represent means ± sem. *P < 0.05 shLIN28B vs. scrambled (A–C) or LIN28B vs. control (D, E).

Article Snippet: HTR8/SVneo cells were transfected with green fluorescent protein (GFP) or pFRT/FLAG/HA-DEST LIN28B plasmid, a gift from T. Tuschl (The Rockefeller University, New York, NY, USA) (43798; Addgene, Cambridge, MA, USA) ( 29 ) using 25 kDa linear polyethylenimine (23966; Polysciences, Philadelphia, PA, USA).

Techniques: Expressing, Western Blot, Control, shRNA, Knockdown, Transfection, Over Expression

Hypoxia reduces expression of LIN28B in JEG3 and BeWo cells. A) Representative immunoblot for LIN28B in JEG3 and BeWo cells cultured in standard culture conditions (21% oxygen) or hypoxia (1% oxygen) for 72 h. B, C) Densitometric quantification of LIN28B protein expression normalized to α-tubulin (B) and qPCR analysis for LIN28B mRNA expression normalized to GAPDH (C) after 72 h of normal culture conditions or hypoxia. D) qPCR analysis for let-7a and let-7g in JEG3 and BeWo cells after culture in standard culture conditions or hypoxia for 72 h. E, F) qPCR analysis for indicated genes expressed by JEG3 cells (E) and BeWo cells (F) after culture in standard culture conditions or hypoxia for 72 h. Results represent means ± sem. *P < 0.05 for 1 vs. 21% oxygen standard culture conditions.

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: Hypoxia reduces expression of LIN28B in JEG3 and BeWo cells. A) Representative immunoblot for LIN28B in JEG3 and BeWo cells cultured in standard culture conditions (21% oxygen) or hypoxia (1% oxygen) for 72 h. B, C) Densitometric quantification of LIN28B protein expression normalized to α-tubulin (B) and qPCR analysis for LIN28B mRNA expression normalized to GAPDH (C) after 72 h of normal culture conditions or hypoxia. D) qPCR analysis for let-7a and let-7g in JEG3 and BeWo cells after culture in standard culture conditions or hypoxia for 72 h. E, F) qPCR analysis for indicated genes expressed by JEG3 cells (E) and BeWo cells (F) after culture in standard culture conditions or hypoxia for 72 h. Results represent means ± sem. *P < 0.05 for 1 vs. 21% oxygen standard culture conditions.

Article Snippet: HTR8/SVneo cells were transfected with green fluorescent protein (GFP) or pFRT/FLAG/HA-DEST LIN28B plasmid, a gift from T. Tuschl (The Rockefeller University, New York, NY, USA) (43798; Addgene, Cambridge, MA, USA) ( 29 ) using 25 kDa linear polyethylenimine (23966; Polysciences, Philadelphia, PA, USA).

Techniques: Expressing, Western Blot, Cell Culture

Aberrant LIN28B expression and DNA repair pathway are associate with MSE. (a) Integrated analysis combining scRNA‐seq data from ascites in a constructed preclinical OC model; scRNA‐seq data from MA in OC patients ( n = 13), and gene mutation profiles from MSE in cancer patients ( n = 442) to explore novel dual‐targeting therapeutic strategies (created at BioRender.com). (b) Venn diagram analysis of DEG targets between the preclinical OC model and OC patients (Nat Cancer. 2023). GO‐BP enrichment analysis for (c) SNV gene mutations and (d) CNV gene mutations in MSE from cancer patients. (e) Waterfall plot for top 45 SNV genes and relative pathways. Genotype Quality (GQ): Minimum threshold of 20 (99% confidence in the genotype call). Read Depth (DP): Site‐specific depth filters (DP ≥ 10 for high‐confidence calls, adjusted for cohort mean depth). lternate Allele Support: Minimum alternative allele reads (≥ 3) and fraction (AF ≥ 0.25 for heterozygous germline calls). opulation Frequency: Filtering against population databases (gnomAD allele frequency < 0.01 for rare variants, < 0.001 for ultra‐rare). (f) Heatmap of CNV genes in MSE from cancer patients ( n = 442). Quality Metrics: Segment‐wise log2 ratio standard deviation or confidence score (e.g., CNVkit quality score > 0.5). Size Threshold: Typically, > 1 kb for targeted sequencing and > 10–50 kb for whole‐genome sequencing to exclude small, noisy calls. Copy State Threshold: Log2 ratio thresholds define copy states (e.g., deletion: log2 ratio < −0.4, duplication: log2 ratio > 0.2).

Journal: Advanced Science

Article Title: PARPi Combining Nanoparticle LIN28B siRNA for the Management of Malignant Ascites

doi: 10.1002/advs.202510547

Figure Lengend Snippet: Aberrant LIN28B expression and DNA repair pathway are associate with MSE. (a) Integrated analysis combining scRNA‐seq data from ascites in a constructed preclinical OC model; scRNA‐seq data from MA in OC patients ( n = 13), and gene mutation profiles from MSE in cancer patients ( n = 442) to explore novel dual‐targeting therapeutic strategies (created at BioRender.com). (b) Venn diagram analysis of DEG targets between the preclinical OC model and OC patients (Nat Cancer. 2023). GO‐BP enrichment analysis for (c) SNV gene mutations and (d) CNV gene mutations in MSE from cancer patients. (e) Waterfall plot for top 45 SNV genes and relative pathways. Genotype Quality (GQ): Minimum threshold of 20 (99% confidence in the genotype call). Read Depth (DP): Site‐specific depth filters (DP ≥ 10 for high‐confidence calls, adjusted for cohort mean depth). lternate Allele Support: Minimum alternative allele reads (≥ 3) and fraction (AF ≥ 0.25 for heterozygous germline calls). opulation Frequency: Filtering against population databases (gnomAD allele frequency < 0.01 for rare variants, < 0.001 for ultra‐rare). (f) Heatmap of CNV genes in MSE from cancer patients ( n = 442). Quality Metrics: Segment‐wise log2 ratio standard deviation or confidence score (e.g., CNVkit quality score > 0.5). Size Threshold: Typically, > 1 kb for targeted sequencing and > 10–50 kb for whole‐genome sequencing to exclude small, noisy calls. Copy State Threshold: Log2 ratio thresholds define copy states (e.g., deletion: log2 ratio < −0.4, duplication: log2 ratio > 0.2).

Article Snippet: The following antibodies were used: anti‐human LIN28B (Cell Signaling Technology, 4196S, 1:1000), anti‐mouse Lin28b (Proteintech, 11724‐1‐AP, 1:500), anti‐β‐actin (ABclonal, AC026, 1:10000), StarBright Blue 520 goat anti‐mouse IgG (Bio‐Rad, 12005867, 1:10000), Alexa Fluor Plus 800 goat anti‐rabbit IgG (H + L) (Invitrogen, A32735, 1:10000), Anti‐Mouse CD8a‐Purified In vivo (C375‐25 mg), Anti‐Mouse NK1.1‐Purified In vivo (N123‐25 mg), Human/Primate IL‐6 Mab(Clone 6708, MAB206‐SP, R&D), Human TNF‐alpha Mab(Clone28401, MAB610‐SP, R&D), anti‐CD31 antibody (Thermo Fisher Scientific, MA3105, 1:200), and anti‐TER‐119 antibody (BD Biosciences, 557915, 1:100).

Techniques: Expressing, Construct, Mutagenesis, Standard Deviation, Targeted Sequencing, Sequencing

Synthesis and characterization of DSSP@lip‐PEG‐FA targeting LIN28B.(a) Schematic illustration of the synthesis process for siRNA/DSSP@lip‐PEG‐FA. Representative TEM images and size distribution profiles of siRNA/DSSP NPs (b) and siRNA/DSSP@lip‐PEG‐FA (c). (d) hydrogen peroxide (H 2 O 2 )‐ and glutathione (GSH)‐responsive siRNA release profiles under different conditions (pH 7.4, pH7.4& 1 mM H 2 O 2 , and pH 7.4 & 10 mM GSH) over 24 h. (e) Confocal microscopy images (scale bars: 50 µm) and quantitative analysis of cellular uptake efficiency for free siRNA, siRNA/DSSP@lip‐PEG, and siRNA/DSSP@lip‐PEG‐FA. (f) Flow cytometric analysis quantifying Cy3‐labeled siRNA fluorescence intensity in treated cells. (g) Flow cytometry evaluation of folate receptor (FA)‐targeting specificity. (h) Mean fluorescence intensity (MFI) comparison across different treatment groups at 6 h post‐incubation. (i) Confocal images showing intracellular distribution of siRNA/DSSP@lip‐PEG‐FA (scale bar: 10 µm). (j) Quantitative colocalization analysis performed using ImageJ software. (k) and (l) Western blot analysis of Lin28b protein expression in A2780 and ID8 ovarian cancer cells following various treatments. Data are presented as mean ± SD ( n = 3, unpaired t‐test). n = independent biological replicates. * p < 0.05, ** p < 0.01, *** p < 0.001; ns, not significant.

Journal: Advanced Science

Article Title: PARPi Combining Nanoparticle LIN28B siRNA for the Management of Malignant Ascites

doi: 10.1002/advs.202510547

Figure Lengend Snippet: Synthesis and characterization of DSSP@lip‐PEG‐FA targeting LIN28B.(a) Schematic illustration of the synthesis process for siRNA/DSSP@lip‐PEG‐FA. Representative TEM images and size distribution profiles of siRNA/DSSP NPs (b) and siRNA/DSSP@lip‐PEG‐FA (c). (d) hydrogen peroxide (H 2 O 2 )‐ and glutathione (GSH)‐responsive siRNA release profiles under different conditions (pH 7.4, pH7.4& 1 mM H 2 O 2 , and pH 7.4 & 10 mM GSH) over 24 h. (e) Confocal microscopy images (scale bars: 50 µm) and quantitative analysis of cellular uptake efficiency for free siRNA, siRNA/DSSP@lip‐PEG, and siRNA/DSSP@lip‐PEG‐FA. (f) Flow cytometric analysis quantifying Cy3‐labeled siRNA fluorescence intensity in treated cells. (g) Flow cytometry evaluation of folate receptor (FA)‐targeting specificity. (h) Mean fluorescence intensity (MFI) comparison across different treatment groups at 6 h post‐incubation. (i) Confocal images showing intracellular distribution of siRNA/DSSP@lip‐PEG‐FA (scale bar: 10 µm). (j) Quantitative colocalization analysis performed using ImageJ software. (k) and (l) Western blot analysis of Lin28b protein expression in A2780 and ID8 ovarian cancer cells following various treatments. Data are presented as mean ± SD ( n = 3, unpaired t‐test). n = independent biological replicates. * p < 0.05, ** p < 0.01, *** p < 0.001; ns, not significant.

Article Snippet: The following antibodies were used: anti‐human LIN28B (Cell Signaling Technology, 4196S, 1:1000), anti‐mouse Lin28b (Proteintech, 11724‐1‐AP, 1:500), anti‐β‐actin (ABclonal, AC026, 1:10000), StarBright Blue 520 goat anti‐mouse IgG (Bio‐Rad, 12005867, 1:10000), Alexa Fluor Plus 800 goat anti‐rabbit IgG (H + L) (Invitrogen, A32735, 1:10000), Anti‐Mouse CD8a‐Purified In vivo (C375‐25 mg), Anti‐Mouse NK1.1‐Purified In vivo (N123‐25 mg), Human/Primate IL‐6 Mab(Clone 6708, MAB206‐SP, R&D), Human TNF‐alpha Mab(Clone28401, MAB610‐SP, R&D), anti‐CD31 antibody (Thermo Fisher Scientific, MA3105, 1:200), and anti‐TER‐119 antibody (BD Biosciences, 557915, 1:100).

Techniques: Confocal Microscopy, Labeling, Fluorescence, Flow Cytometry, Comparison, Incubation, Software, Western Blot, Expressing